PAL1, PAL1 (gene) Fragaria x ananassa

Gene Overview
Name PAL1
Gene Symbol PAL1
Type gene
Organism Fragaria x ananassa
Synonym phenylalanine ammonia-lyase
phenylalanine ammonia-lyase 1
FaPAL1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
phenylalanine ammonia lyasePALFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PAL1AB360390.1-PAL1.m1Fragaria x ananassamRNA
PAL1KX450226.1-PAL1.m1Fragaria x ananassamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB360390.1-PAL1.m1 LG6:8936538..8937101
AB360390.1
mRNA parsed from NCBI nr database KX450226.1-PAL1.m1 N/A KX450226.1

Sequence(s):
>AB360390.1-PAL1.m1563
agtgctgagcagcacaaccaggatgtcaactctttggggctgatttcgtcacgaaaaactgcagaagcagttgacatact
gaagctcatgtcttccacatttttggtagcgctttgccaagccattgatttgaggcatttggaggagaacttgaagagca
cggttaagaacactgtgagtcagttggccaagaggcttttaactaccggggtgaatggagagcttcacccttcgaggttc
tgtgagaaggatttgcttatggttgtcgaaagggagtaccttttcgcctacattgacgatccttgcagcgctacatatcc
gttgatgcaaaggctaaggcaagtgcttgttgaacacgccttgacaaatggtgaaaatgagaagaacgcaaacacttcaa
ttttccaaaagatttcggcatttgaggaagagcttaagaccattttgcctaaagaggttgagagcgttagggctgcatgc
gagagcggtaatgcggcgattccaaacagaatcatcgagtgcaggtcatatcctttgtacaaatttgtgagggaggagtt
ggg
back to top
>KX450226.1-PAL1.m12157
atggcgcttaacggaaacggaaactgcaacggggcggcagcggtgggctcattttgccaaggaggaggactactacatga
cccgttgaactggaacttggcggcggaggggttgaaagggagccacctggacgagctgaaaagaatggtgaatgactacc
ggaagccggtggtgatgctgggaggggagagcctcactgtagggcaggtggcggcgattgccaaccacgacggtggcgtg
cgcgtggagctttccgaggagaagcgggctggggtgaaggccagcagtgactgggtcatggattcaatggggaagggtac
agacagttacggtgtcaccaccgggttcggtgctacctcccaccggagaaccaaaaacggtggagctctccagaaagaac
tcatcagattcttgaatgccggaatctttggcagcagcttagactctactcacaaattgcctcacaccgcaacaagggcg
gcgatgctagtaaggatcaacaccctcctccagggttactcggggattaggttcgaaatcttggaagccattaccaaact
cctcaatggtaacatcactccatgcctgccacttcggggcacgatctcgtcgtcgggtgacttggttcccctttcataca
ttgccgggcttttgatcggcaggcccaattcaaagtccattgggcctaatggcgagaccctaaccccggctgaggcgttt
aagttggccggaattgagggtgatttctttgaattgcaacccaaggaaggacttgctttggtgaatggtactgctgttgg
gtctggtatggcttctgtggtgctgtttgatgctaacactctagctgttctttccgagatcatgtcagcgattttcgctg
aagttatgcaaggaaagccggagtttacagaccacttgacacataaactgaagcaccaccctggccagattgaagctgca
gccataatggagcacattcttgatggaagctcatatgtgaaagaagcgaagaaggttcatgaaatggaccctcttcaaaa
gcctaagcaagacagatatgctctaagaacctccccacaatggctaggccccttgattgaggtgatcagatcatcaacca
aaatgattgagagggagatcaactctgtcaacgacaatccattgatcgatgtctcaaggaacaaggccttacatggtgga
aacttccaaggaaccccaattggtactgccatggacaacaccagactcgcccttgcctccattggaaaactcatatttgc
acaattttctgagcttgtcaatgacttctacaacaatggcttgccttccaacctctcaggtggtagcaacccaagtttgg
actacggcttcaaaggtgcagaaatcgcaatggcatcatactgctccgagcttcagttcctagccaaccccgtgaccaac
catgtccaaagtgctgagcaacacaaccaagatgtcaactccttgggactgatctcctctagaaaaacatccgaggctgt
cgacattttgaagctaatgtcatcaacattcctagttgcattgtgccaagctgttgatctcaggcatatggaagagaact
tgaagagcgttgtcaagaacactgtaagtaaagtggccaggaggactctcaccgttgcccctaacggtgagcttcacccc
tctcgattctcagagaaacacctgctctcagtcgtggaccgcgagtaccttttctcctacattgacgacccctgccttgc
tacctatccattgatgcaaaaactgagggcagagctagtagaacatgccttgaataatggtgacaaagagaagagcacaa
acacctccatcttcctcaagattgctgcttttgaagaggaactgaagagtgtcttgcctaaagaagtcgacaatgctagg
atggaaattgagaatgggaaagcagaaattgcaaacaggatcaaggaatgcaggtcttatccattgtacaggtttgtgag
ggaggaattggggactagtttattgactggtgagaagatcaggtcacctggagaagaatgtgacaaggtgttcaacgcaa
tctgcgctgggaagctgattgaccctctgctggagtgtctgaaggagtggaatggtgcccccctgcccatatcttag
back to top