C4H, HM204477.1-C4H.m1 (mRNA) Prunus armeniaca

Transcript Overview
Unique NameHM204477.1-C4H.m1
OrganismPrunus armeniaca (Apricot)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
C4HHM204477.1-C4HPrunus armeniacagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
C4HC4HPrunus armeniacagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM204477.1-C4H.m1-cds1HM204477.1-C4H.m1-cds1Prunus armeniacaCDS
HM204477.1-C4H.m1-cds2HM204477.1-C4H.m1-cds2Prunus armeniacaCDS
HM204477.1-C4H.m1-cds3HM204477.1-C4H.m1-cds3Prunus armeniacaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
C4HHM204477.1-C4H.p1Prunus armeniacapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM204477 region HM204477:103..2856+ NCBI Rosaceae gene and mRNA sequences
scaffold_6 supercontig scaffold_6:2187091..2189969- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productcinnamate 4-hydroxylase
The following sequences are available for this feature:

mRNA sequence

>HM204477.1-C4H.m1 ID=HM204477.1-C4H.m1|Name=C4H|organism=Prunus armeniaca|type=mRNA|length=1515bp
back to top

protein sequence of C4H

>HM204477.1-C4H.p1 ID=HM204477.1-C4H.p1|Name=C4H|organism=Prunus armeniaca|type=polypeptide|length=504bp
back to top

mRNA from alignment at HM204477:103..2856+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM204477.1-C4H.m1 ID=HM204477.1-C4H.m1|Name=C4H|organism=Prunus armeniaca|type=mRNA|length=2754bp|location=Sequence derived from alignment at HM204477:103..2856+ (Prunus armeniaca)
atggacctactcctcctggaaaagaccctcctgggtctcttcatcgccgt catcgtcgcaatcactatttcgaagctccgtggcaagcggttcaagctcc cgcccggtccgatacccgtaccagttttcggaaactggctccaggtcggc gacgacctcaatcaccggaacctcaccgacctcgcgaaaaagttcggcga catcttcctcctccgcatggggcagcgcaatttggtggtggtctcgtccc ctgacctcgccaaggaggtcctccacacccagggcgtcgaattcgggtcg aggacacgaaacgtcgtgttcgatattttcaccggtgagggccaggatat ggtgttcacggtctacggtgagcactggaggaagatgaggcggatcatga ccgttcctttcttcactaacaaggtcgtgcagcagtataggcacggctgg gaatcggaggcagcggcggtggttgaggacgtgaagaagtacccggggtc tgcgaccaatgggatggtgctgcggaggcggttgcagctgatgatgtaca acaacatgtaccggattatgttcgatcggaggttcgagagcgaggaggat cctctgtttatgaagctcaaggggttgaatggggagaggagccgattggc tcagagcttcgattacaattatggagattttatccccattttgagaccct tcttgagaggctacttgaagatctgcaaagaggtcaaggagaagagaatt cggctgttcaaggactactttgttgatgaacggaagtaagattttttttt ttttttacttaattcaattttgttatttatgttgaaaaacattagtgtct aattagtaaaagataaaaatgaaactgttactggaactctaatttgtcgt cctgcattgaaaaagaaacgaataagaatgacaaactgatagtgtaaata agtattactggtcaaatataccacgttagtagcatgagtattatgaatgg tttccttttttgggtctaatggaaattttttttttccactttcaaaatat gtgaagttttctatttttatagaatatttgattatatctgaaatgaaatt tgattttaattgttgagcaggaaactttcaagcacaaaaacgacaacaaa tgaaggactgaagtgcgccatcgaccatatcctggacgctcagcagaagg gagagatcaacgaggacaacgtcctttacatcgtcgagaacatcaacgtt gctggtaagtggggccctcacttccctagtctcctaatttttaccacagc aacacagtgccatgcatttttactgctttacccaattttttcgagaggtt attatgggaaatgccaatggcgcttctcttaaaattttcacatgatttat gcagaacaaacaaaaaataaatcctataaaacttaccgttcataattgca agcctgcgaaattcggtgcccttgtcgccggtgtttattgtgaggataaa ttttttgacctgttcttccactcttttattttatattttcttacaaataa tattacaattaatcctagattttatttaaatcgcaattaaaacattaacg ggtctagttgagtgaaaaagtgaattgacatgcagattagagggcttaag ttcgaaccccataatatcttggttacaagacaaaattgattatttcaacg ccaacttagaactcattttaagtatttaagttattttcaactctatttta acccaaaccattggttgtcctgcatcgtgacatgattccttttcaggtta ggtgataaatatttgtttaaatctgaatatgtcaaatccactttattagg tgcatctaggtgaacaaaacatgtggcttcaatgttaatacatacaacct agcaactttcttgggtttccttataatgatggaaacatacacatcttatc ctctacattagttaaacttcattttatgtacaatccactttcttcttgcc aacccctgtgacattgactgccaactcactttccatttggacactacaga ttaatcacagtctgatatatgtgcataaactttactctttgtaattttaa taacgtatctaactcgttacagataatcagagtctaatatattttttttg attaacagcaattgaaacaacactatggtcaattgagtgggggattgcag agcttgtgaaccaccctgagatccaaaagaagctgagggatgagcttgac tcagtgcttggccctggtgttcaaatcacagagccagagatccagaagct tccctaccttcaagctgtgatcaaagagactctcaggcttcgcatggcaa tcccattgcttgtcccacacatgaatctcaacgatgcaaagctgggcagc tacgacattccagcggagagcaagatcctggtgaatgcatggtggctggc aaacaaccctgccctctggaagaagcctgaggagtttaggccagagaggt ttttggaggaagaggccaaggttgaggccaatggcaatgactttaggtac cttccatttggtgttgggagaagaagctgtccagggattattttggccct tccaattcttgggatcactttgggacgtttagtccagaactttgagctct tgcctcctcctggacagtccaagcttgacaccacagagaaaggtgggcag ttcagcttgcacattttgaagcactctaccattgtgttgaagccaaggtc atag
back to top

Coding sequence (CDS) from alignment at HM204477:103..2856+

>HM204477.1-C4H.m1 ID=HM204477.1-C4H.m1|Name=C4H|organism=Prunus armeniaca|type=CDS|length=1515bp|location=Sequence derived from alignment at HM204477:103..2856+ (Prunus armeniaca)
back to top