PI, PI (gene) Neillia incisa

Gene Overview
Name PI
Gene Symbol PI
Type gene
Organism Neillia incisa
Synonym pistillata MADS-box protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PIKC759430.1-PINeillia incisagene
PIKC759429.1-PINeillia incisagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PIKC759430.1-PI.m1Neillia incisamRNA
PIKC759429.1-PI.m1Neillia incisamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
pistillata MADS-box proteinPINeillia incisagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC759430.1-PI N/A KC759430.1
gene parsed from NCBI nr database KC759429.1-PI N/A KC759429.1
mRNA parsed from NCBI nr database KC759430.1-PI.m1 N/A KC759430.1
mRNA parsed from NCBI nr database KC759429.1-PI.m1 N/A KC759429.1

Sequence(s):
>KC759430.1-PI1050
tggaaagatggttgaatactgcagcccttccacttcgtaggcacctaaattaaacctcctcatgttattttttcttctca
tttctttcttttaatttgttggttttttaatcaatttctccttcaatttaacaagaaaaaaaggtacttttttaaatcta
tgttaatattatgaggttctctataatttttatctatattttatgaattaatctaattaatttcttcttgatgtgatgaa
ggttgactgatatcttggacaaataccatggccagtctgggaagaagttgtgggatgctaagcatgaggtttgatatatt
tcctctctctattttctcgttattttttttgaataatgaaagatctgttgggttcttacgtacttttctcaaatggaaac
taacatggttttgtttttatttttgctaaaaatatgttaagaaacatgaagtgcgatttctatgaacagatctacaaata
ggatgtactagttggctctctttctcctgctctgatagtttttctaactgacgttctttgttgacaaagaaaactgaaac
tatgtgaaatgtaacatccatgaacagatctggtaataaaatgatattctctcccttccttttctttgcaaaaaattgaa
acaaatcagtggttgttagttttatatataaatgagagtatgtcacataaatatttttggatacgtcttttcttgatata
aatataaaagctctcgatctgatctgtgtacccttgggttcctcgactgatacaaatcatagaaaccccatatatatata
tatagatatatatatatacgcacttttctgctagctaacagatctgcatatgaaaatatatagatcagaccctcttttat
ggtttgtatttatttcttttaatatatagcataatctttgttttgatttaaattgtttttgttttgcttataaatatttg
atatattaagctaattgactgagggtttgcaacaaattaatttgataaactcttaatcacacacacagaacctcagcaat
gaagtggaca
back to top
>KC759429.1-PI1053
tggaaagatggttgaatactgcagcccttccacttcgtaggcacctaaattaaacctcctcatgttattttttcttctca
tttctttcttttaatttgttggttttttaatcaatttctccttcaatttaacaagaaaaaaaaggtacttttttaaatct
atgttaatattatgaggttctctataatttttatctatattttatgaattaatctaattaatttcttcttgatgtgatga
aggttgactgatatcttggacaaataccatggccagtctgggaagaagttgtgggatgctaagcatgaggtttgatatat
ttcctctctctattttctcgttattttttttgaataatgaaagatctgttgggttcttacgtacttttctcaaatggaaa
ctaacatggttttgtttttatttttgctaaaaatatgttaagaaacatgaagtgcgatttctatgaacagatctacaaat
aggatgtactagttggctctctttctcctgctctgatagtttttctaactgacgttctttgttgacaaagaaaactgaaa
ctatgtgaaatgtaacatccatgaacagatctggtaataaaatgatattctctcccttccttttctttgcaaaaaattga
aacaaatcagtggttgttagttttatatataaatgagagtatgtcacataaatatttttggatacgtcttttcttgatat
aaatataaaagctctcgatctgatctgtgtacccttgggttcctcgactgatacaaatcatagaaaccccatatatatat
atatatagatatatatatatacgcacttttctgctagctaacagatctgcatatgaaaatatatagatcagaccctcttt
tatggtttgtatttatttcttttaatatatagcataatctttgttttgatttaaattgtttttgttttgcttataaatat
ttgatatattaagctaattgactgagggtttgcaacaaattaatttgataaactcttaatcacacacacagaacctcagc
aatgaagtggaca
back to top
>KC759430.1-PI.m1103
tggaaagatggttgaatactgcagcccttccacttcgttgactgatatcttggacaaataccatggccagtctgggaaga
agttgtgggatgctaagcatgag
back to top
>KC759429.1-PI.m1103
tggaaagatggttgaatactgcagcccttccacttcgttgactgatatcttggacaaataccatggccagtctgggaaga
agttgtgggatgctaagcatgag
back to top