PL1, PL1 (gene) Prunus persica

Gene Overview
Name PL1
Gene Symbol PL1
Type gene
Organism Prunus persica
Synonym pectate lyase
PpPL1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
pectate lyasePLPrunus persicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PL1AB264095.1-PL1.m1Prunus persicamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB264095.1-PL1.m1 scaffold_5:14193935..14195645
AB264095.1

Sequence(s):
>AB264095.1-PL1.m11242
atggcaaggccctccttaggcccctcacctctctctctcctcagcttcctcctcttctgtctcctcaccccaaccctcat
tgcctccagaccactgcagcaaaaccctgaattggttgtacaagatgtacaaaggagcatcaatgactctgtttctagga
ggaacttgggctacttgtcatgcgggactggaaaccccattgatgattgctggcgatgtgacccaaattgggagcagaac
aggcagaggctggcagattgcgcaattgggtttgggaaaaatgccattggtggaagagatggcaagatttacgtggtcac
ggattcaggggataacgaccctgtaaacccaaagccagggactctacgacatgccgttattcaggacgagccactgtgga
tcatcttccagcgtgatatgacaatccaactgaaggaagagctgatcatgaactctttcaagaccatcgacggtcgagga
gccagcgtgcacattgctggtgggccatgcaatcaccgtccatttgtgaccaacattatcattcatggtctgcacataca
cgattgcaagccgggagggaatgctatggtgcggtcctccccagagcactacgggtggaggactatatccgacggtgacg
gtgtgtccatcttcggtgggagccacgtgtgggtggaccattgctctttgtcaaattgcaaagatgggttggttgatgca
attcatgggtccactgccataacaatttcgaacaattacatgactcaccatgacaaagtgatgttgcttgggcatagcga
ttcttataccgaagataagaacatgcaagtcaccatagccttcaatcactttggagaaggtttggtccagagaatgccaa
gatgtaggcatggatatttccatgtggtgaacaatgactacacccattgggagatgtatgccattggaggcagtgccaac
cctacaatcaatagccaagggaatagatttgctgcaccagatatcagatttagcaaagaggtgacaaaacatgaggatgc
accagaaagtgaatggaggaattggaattggaggtctgaaggagacttgatgataaatggtgcattttttacagcatcag
gagctggagcttcctcaagctatgcaagggcttcaagcttgggggcaaagccatcttctctagtgggttcaataaccaca
gcttctggtgcacttagctgcagaaagggttctcgttgctga
back to top