PL, PL (gene) Pyrus x bretschneideri

Gene Overview
Name PL
Gene Symbol PL
Type gene
Organism Pyrus x bretschneideri
Synonym pectate lyase
Description NA
Comment forms right handed beta helix structure; involved in maceration and soft rotting of plant tissue
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PLKJ547669.1-PL.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
pectate lyasePLPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KJ547669.1-PL.m1 scaffold01715:4349..6245
KJ547669.1

Sequence(s):
>KJ547669.1-PL.m11245
atgccaaaaatggcaaggccctcctcaggcccctcacttctctctctcctcctcctctctctcctcttcccaaccctcat
ttcctccaggccacttcatctccaagaccctgaattggtagtacaagaggtacaaaggaatattagcgactcagtgtcta
ggaggaacttgggctacttgtcatgcgggacgggcaaccctatcgacgactgctggcggtgcgacccgaactgggagaag
aacaggcagagcctagcagattgtgcgatagggttcggaaagaacgccataggtggaagagacgggaagatttacgtggt
cacagattccggcgacgacgaccctgtgaaccccaagccaggaaccctacgacacgccgtcatccaagaggagccattat
ggatcattttccagcgcgacatgaccatccagctgaaggaggagctgatcatgaactccttcaagacaatcgacggccgg
ggagcgtccgtacacattgccggtgggccatgcatcaccatccagttcgtgaccaacattattatccacggactgcacat
acacgattgcaagcagggtgggaacgctatggtgaggagctcccccagtcacttcgggtggaggaccgtatcggacggcg
acggcgtgtcgatcttcggtgggagccacgtgtgggtggaccattgctcgttgtccaactgcaaagatgggttggttgat
gcgatttatgggtccactgcgataacgatttcgaacaattacatgacgcaccatgataaggtgatgcttttggggcatag
cgattcgtataccaaggacaagaacatgcaaatcaccattgcgttcaatcactttggagaaggcttggtccaaagaatgc
caagatgtaggcatggatatttccatgtggtgaacaatgactacacccattgggagatgtatgccattggtgggagtgca
gaccctacaatcaatagccaagggaacagatttgctgcaccagatatcagatccagcaaagaggtgaccaaacatgagga
tgcacccgaaagtgaatggaagaattggaactggaggtcggaaggagacttgctgctcaacggtgcgttttttacggcat
caggtgccggagcttcctcaagctacgccagggcttcgagcttgggtgcgaagccatcttctctagtgggtgcgattacc
acggcttccggcgcactcagttgccggaagggctctcgttgctga
back to top