PP2-1, PP2-1 (gene) Malus x domestica

Gene Overview
Name PP2-1
Gene Symbol PP2-1
Type gene
Organism Malus x domestica
Synonym phloem protein 2
Description phloem lectin
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PP2-1FN395067.1-PP2-1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
phloem proteinPPMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly FN395067.1-PP2-1.m1 Chr05:47163687..47164774
chr5:680456..681543
chr5:676848..677935
FN395067.1

Sequence(s):
>FN395067.1-PP2-1.m1645
atggctactgatgctaaagcgcaagaggaaaagcggtcattcccacataagtatgaagacattctgaaagattttggcgc
aagtaacgactcgtcctcacctgcaaaagtcccttcgaaggtcaaatatccaggaattttcgaccaaccgaaaaagaaaa
ggtattgggttgatagggagggcaacaactgttttgtgctgtatgcaagagctctcacaatcactttcggtgaagacgat
cgttactggcgctggaaccccgtgtacgcagccagttctgtctacgttgatgctgctgaactgttagatgtattatcgct
agaagtgaaaggggattttgagaccgcatacctgacgcccggaactgtgtatgaagtttcatatataatcatgatgaagg
acccaaaatatggatgggaagataaagtcgaattcagcgtcactccccctcagaacctgcagattgtcccgagaaactct
acacttgatctgaggacaaaaggaagatggtggagttatgtccgagttgccgaatttacaacatcgcctgggcaatctgg
ccggatgtattttatgctccgtcaaactgttgggaaatggaagaaagggcttgttatcaagggtgtcgacattactccta
aataa
back to top