CYP, JN979371.1-CYP.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameJN979371.1-CYP.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CYPCYPFragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JN979371.1-CYP.m1-cds1JN979371.1-CYP.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CYPJN979371.1-CYP.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JN979371 region JN979371:69..1133+ NCBI Rosaceae gene and mRNA sequences
LG6 chromosome LG6:35085957..35088200- Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Productcysteine protease
The following sequences are available for this feature:

mRNA sequence

>JN979371.1-CYP.m1 ID=JN979371.1-CYP.m1|Name=CYP|organism=Fragaria x ananassa|type=mRNA|length=1065bp
back to top

protein sequence of CYP

>JN979371.1-CYP.p1 ID=JN979371.1-CYP.p1|Name=CYP|organism=Fragaria x ananassa|type=polypeptide|length=354bp
back to top

mRNA from alignment at JN979371:69..1133+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JN979371.1-CYP.m1 ID=JN979371.1-CYP.m1|Name=CYP|organism=Fragaria x ananassa|type=mRNA|length=1065bp|location=Sequence derived from alignment at JN979371:69..1133+ (Fragaria x ananassa)
atgtcgacctccatgaccctaaccctcttcaccctcctcttcctctcctt caccctctctcacgcctccgacctccgcaccgatgccgaggtccgggagc tctaccagaactggctcgtcaagcaccagaaagtctacaacggcatcgga gaggaggagaccaggttccagatcttcaaggacaacttgaagttcgtcga tgaacacaacgctgagagcaggtcgtacaaggttggcatgaacgccttcg ccgacttgaccaaccaggagtaccgtgctaggtttctcggaacccgccct gaccctaagaggagggtcatgaaggccaagaaccccagcctcaggtacgt tgtccgccccgacgacaagttgccggaatccgtcgactggagagctttgg gggctgttaacccgatcaaaaaccaaggcagctgcggaagttgctgggca ttttcaactgtggctgcagtggaaggcattaacaagatagccacaggaga actagtctctctttcagagcaagagcttgttgactgtgacaggaagtaca acgctggctgcaacggaggccttatggactatgctttcgagttcatcatc aaaaacggtggcatggacaccgaatcagactacccttacaaagcagtcaa ccaacagtgtgacgcttctttggagaacaacaaggttgttaccattgatg gttacgaagatgttccagctttcaacgaggaggctttgaagaaagctgta gcacatcaacctgtaagtgttgccattgaagctggtggcgttgctcttca gctctatgactcgggtgtgtttaccggtgaatgtggatcagcacttgatc atggtgtggttgctgttggttatggcactgagaatggtgtggactactgg ctggtgaggaactcatggggaaccaactggggtgagggtggatatttcaa gatcgagcgcaatgtgaagagcacatatactggcaagtgtggtattgcca tggaggcttcttacccgaccaaggatagtgcacagaacccaatccagatg gtcaccagcatgtga
back to top

Coding sequence (CDS) from alignment at JN979371:69..1133+

>JN979371.1-CYP.m1 ID=JN979371.1-CYP.m1|Name=CYP|organism=Fragaria x ananassa|type=CDS|length=1065bp|location=Sequence derived from alignment at JN979371:69..1133+ (Fragaria x ananassa)
back to top