CBF, KC543503.1-CBF.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameKC543503.1-CBF.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBFCBFMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KC543503.1-CBF.m1-cds1KC543503.1-CBF.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CBFKC543503.1-CBF.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KC543503 region KC543503:1..756+ NCBI Rosaceae gene and mRNA sequences
Chr04 chromosome Chr04:9200516..9201271+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr4 chromosome chr4:4894474..4895229+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr4 chromosome chr4:5294474..5295229+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductCBF/DREB 4
Genbank noteAP2/ERF transcription factor family; low temperature response pathway
The following sequences are available for this feature:

mRNA sequence

>KC543503.1-CBF.m1 ID=KC543503.1-CBF.m1|Name=CBF|organism=Malus x domestica|type=mRNA|length=756bp
back to top

protein sequence of CBF

>KC543503.1-CBF.p1 ID=KC543503.1-CBF.p1|Name=CBF|organism=Malus x domestica|type=polypeptide|length=251bp
back to top

mRNA from alignment at KC543503:1..756+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC543503.1-CBF.m1 ID=KC543503.1-CBF.m1|Name=CBF|organism=Malus x domestica|type=mRNA|length=756bp|location=Sequence derived from alignment at KC543503:1..756+ (Malus x domestica)
atgaacacratctccagacaactctccgattccgccgaaaggcccgaatc gagttccgaaagcgtcacgamtcgaagccagccgacttcgttctccgatg aggaggtcattttggcgtccagcacgccgaagaagcgagcggggaggaga gttttcaacgagacaaggcaccccgtttacagaggagtgaggaggaggaa caacgacaagtgggtgtgcgaaatgagagaaccaaacaagaagaagtcga ggatatggctcggaacttatccaacggcagagatggcagctcgggcgcat gacgtggcggcattggcctttagagggaggcttgcctgcctcaattttgc agactccgcatggcgcctgcctgtcccrgcttccactgattcagtggata tcaggcgggcggccgcggaggctgcagagacattcaggccagccgagttt ggcggagtgtcggaaagtggggatgatgagaaggagagcaagaaaatgga gggggagaaggattgtggatgtgcggagcaaagcgattgtggaggtgcgg agcaaagcgattgtggaggtgcggagcaaagtggcagctcgttttacttg gatgaggaggaaatgttcgccatgccaaggttgcttgatagtatggcgga aggscttctgctctctccacctcgccgttcagctggtagcaacatgaact gggatgatatgggaagcaatgatgatgacgtcaatctgtggagcttctca aagtaa
back to top

Coding sequence (CDS) from alignment at KC543503:1..756+

>KC543503.1-CBF.m1 ID=KC543503.1-CBF.m1|Name=CBF|organism=Malus x domestica|type=CDS|length=756bp|location=Sequence derived from alignment at KC543503:1..756+ (Malus x domestica)
back to top