CBF, KC543498.1-CBF.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameKC543498.1-CBF.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBFCBFPrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KC543498.1-CBF.m1-cds1KC543498.1-CBF.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CBFKC543498.1-CBF.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KC543498 region KC543498:1..693+ NCBI Rosaceae gene and mRNA sequences
scaffold_5 supercontig scaffold_5:10054608..10055300- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
ProductCBF/DREB 2
Genbank noteAP2/ERF transcription factor family; low temperature response pathway
The following sequences are available for this feature:

mRNA sequence

>KC543498.1-CBF.m1 ID=KC543498.1-CBF.m1|Name=CBF|organism=Prunus persica|type=mRNA|length=693bp
back to top

protein sequence of CBF

>KC543498.1-CBF.p1 ID=KC543498.1-CBF.p1|Name=CBF|organism=Prunus persica|type=polypeptide|length=230bp
back to top

mRNA from alignment at KC543498:1..693+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC543498.1-CBF.m1 ID=KC543498.1-CBF.m1|Name=CBF|organism=Prunus persica|type=mRNA|length=693bp|location=Sequence derived from alignment at KC543498:1..693+ (Prunus persica)
atggacatgttctccgctcagctttctgactcccccgaccagcctgagtc gagttctttctccgacgccagcgtcaccaccctgccggcatcttcctccg acgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggagg agggttttcaaggagacgaggcacccggtttacaggggcgtgaggagaag gaacaacaacaagtgggtatgtgagttgagagaacccaacaacaagaagt caaggatttggcttggaacgtatccgacggctgagatggctgctcgtgcc catgacgtggcggcattggcgttcagagggaagcttgcctgcataaactt tgctgactccgcatggcggctgcccttgccggcttccatggacaccatgg atattcgaagggcagccgctgaggccgccgaagggttcaggcctgcggag ttcggtggattatccagcggcagcagtgatgagaaggagatgaatttaag cgtggatatggaaaaaaacagcagcttgtgcttgttttatttggatgagg aggaaatgtttgatatgccaaggttgattgataacatggctcaagggctt cttctttctccacctcaatgctcagctggctacttgaattgggatgacgt ggaaactgaagctgatgccaaattatggagtttctctatctga
back to top

Coding sequence (CDS) from alignment at KC543498:1..693+

>KC543498.1-CBF.m1 ID=KC543498.1-CBF.m1|Name=CBF|organism=Prunus persica|type=CDS|length=693bp|location=Sequence derived from alignment at KC543498:1..693+ (Prunus persica)
back to top