KAO, KC433941.1-KAO.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameKC433941.1-KAO.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
KAOKAOMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KC433941.1-KAO.m1-cds1KC433941.1-KAO.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
KAOKC433941.1-KAO.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KC433941 region KC433941:1..1512+ NCBI Rosaceae gene and mRNA sequences
Chr02 chromosome Chr02:27306303..27311146+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr2 chromosome chr2:26788991..26793838- Malus x domestica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productent-kaurenoic acid oxidase
Genbank notecatalyzes ent-kaurenoic acid to ent-7-hydroxykaurenoic acid; rate-limiting enzyme
The following sequences are available for this feature:

mRNA sequence

>KC433941.1-KAO.m1 ID=KC433941.1-KAO.m1|Name=KAO|organism=Malus x domestica|type=mRNA|length=1512bp
back to top

protein sequence of KAO

>KC433941.1-KAO.p1 ID=KC433941.1-KAO.p1|Name=KAO|organism=Malus x domestica|type=polypeptide|length=503bp
back to top

mRNA from alignment at KC433941:1..1512+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC433941.1-KAO.m1 ID=KC433941.1-KAO.m1|Name=KAO|organism=Malus x domestica|type=mRNA|length=1512bp|location=Sequence derived from alignment at KC433941:1..1512+ (Malus x domestica)
atggtgctgggtttggtggtgggtgtgggaacggggctggcttccatttg gatgttacttctgtcgagctttgttggtcttgtggccttctggtggctta tcaagaatgcaaatcggttgctgtatgaaacgcagctgggtgaaaggcag tactccctcccacctggtgacttgggcttgcctttcattggcaacatgtg gtccttcctcagagctttcaaatctaacaatcctgagtcctttctcgaca agtttgtttccagatttgggaaaactggaatctacaaggccttcatgttc gggttcccaagtatcattgttacaacgcctgaaacaagtaaaagagtttt gactgacgacgatgcattcaaacccgggtggcctgtttctactgtggagc taattggaaagaaatcattcataggtatatcttacgaagaacacaaacgt ctaaggagactaacagcagctccagtcaatggtcacgaagcattgtctgt gtacatgaagtacattgaagagattgtcataacgtccttggaaaaatggt ccaaactgggacaaatagagttcttaactcaactcagaaagcttaccttc aagattattatgtacatctttcttagctcagagagcgagccagtcatgga ggctttggagagggaatatacagtacttaactacggagttagagccatgg caatcaatcttccgggatttgcataccataaagcacttaaggctcggaaa aatcttgttgctatatttcaatcaattgtggatgagcgaagagctcaaag aaagtccggaaactactatgtaaagaagaaagatatgatggacgctctgc tggatgttgaggatgacgatggaagaaaacttaacgatgaggacattata gacgtactgctaatgtacttgaatgcaggccatgaatcttctggccatac cataatgtgggctaccgttttcctacaagcaaacccagaagctttccaga gagctaaggctgagcaagaggagattctcaagaggaggccaccaacgcag aagggcttaacactcaaggaatatcgagaaatggactatctttcccaggt gatagatgaaactcttcgcgtgataacattctcactcaccgtctttcgag aggcaaagaaggatgtcaaaataaacggttatagcattcccaagggctgg aaagtattggtttggttcaggagcattcactatgattctgaattatatcc aaacccaacggaattcaacccttccagatgggataatcacacaccaaaag cattaagttttcttccctttggagctggaagccatctgtgccccggaaat gatcttgctaagctggaaatagctattttccttcaccatttcctccttaa ttataagatggaacgcactaatccgggatgccccttgatgtacttgcctc atactaggcctaaagacaattgcgtggcaaaaatcaagaaatgtggatct gcaggggcatga
back to top

Coding sequence (CDS) from alignment at KC433941:1..1512+

>KC433941.1-KAO.m1 ID=KC433941.1-KAO.m1|Name=KAO|organism=Malus x domestica|type=CDS|length=1512bp|location=Sequence derived from alignment at KC433941:1..1512+ (Malus x domestica)
back to top