ACO1, JX876855.1-ACO1.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameJX876855.1-ACO1.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO1ACO1Prunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JX876855.1-ACO1.m1-cds1JX876855.1-ACO1.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO1JX876855.1-ACO1.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JX876855 region JX876855:1..343+ NCBI Rosaceae gene and mRNA sequences
scaffold_3 supercontig scaffold_3:16205609..16206029- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
The following sequences are available for this feature:

mRNA sequence

>JX876855.1-ACO1.m1 ID=JX876855.1-ACO1.m1|Name=ACO1|organism=Prunus persica|type=mRNA|length=343bp
back to top

protein sequence of ACO1

>JX876855.1-ACO1.p1 ID=JX876855.1-ACO1.p1|Name=ACO1|organism=Prunus persica|type=polypeptide|length=113bp
back to top

mRNA from alignment at JX876855:1..343+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JX876855.1-ACO1.m1 ID=JX876855.1-ACO1.m1|Name=ACO1|organism=Prunus persica|type=mRNA|length=343bp|location=Sequence derived from alignment at JX876855:1..343+ (Prunus persica)
gccccccatgcgccactccattgttatcaaccttggtgaccaacttgagg taatcactaatgggaagtacaagagtgtggagcacagagtgattgcccaa actgatggcaccagaatgtcaatagcttccttttacaaccctggcagtga tgctgtcatttatcctgcaccaacactggtggagaaagaagcagaggaga agaatcaagtgtacccgaaatttgtgtttgaagactacatgaagctttat gctggcctcaagttccagcccaaggagccaagatttgaagccatgaaagc agtggaaaccaatatcagtttgggtccaattgcaacagcttaa
back to top

Coding sequence (CDS) from alignment at JX876855:1..343+

>JX876855.1-ACO1.m1 ID=JX876855.1-ACO1.m1|Name=ACO1|organism=Prunus persica|type=CDS|length=343bp|location=Sequence derived from alignment at JX876855:1..343+ (Prunus persica)
back to top