RCY1, RCY1 (gene) Prunus persica

Gene Overview
Name RCY1
Gene Symbol RCY1
Type gene
Organism Prunus persica
Synonym arginine-rich cyclin 1
Description NA
Comment RCY1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RCY1KM400396.1-RCY1.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
arginine-rich cyclinRCYPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KM400396.1-RCY1.m1 scaffold_6:27122014..27122867
KM400396.1

Sequence(s):
>KM400396.1-RCY1.m1525
gtcaagaaagttgctgctagctgtttgtggcttgcatcaaaactggaggaatgccctaaaaaagccaggcaggttatcat
tgttttccacaggatggaatgtaggagggagaacctacccattgagccattggacccgtattcaaagaaatattcggact
tgaagatggagttgagtaaagcagaaagacatattttaaaggagatgggtttcatttgtcatgttgagcatcctcataag
tttatatcaaattatcttgccactctggagacaccagaattaacacaagaagcctggaatctagcaaatgacagtttgcg
tacaacattgtgtgtgcgattcaagagtgaggttgttgcttgtggtgtagtttatgctgctgctcggaggtttcaagtgc
cccttcctgagaatccgccatggtggaaggcatttgatgctgaaaaatcagggattgacgaagtttgtagggtgctggct
catctgtacagccttcctaaagcaaagtacgtaccagtctgtaag
back to top