CNR12, KC139086.1-CNR12.m1 (mRNA) Prunus avium

Transcript Overview
Unique NameKC139086.1-CNR12.m1
OrganismPrunus avium ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
CNR12KC139086.1-CNR12Prunus aviumgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CNR12CNR12Prunus aviumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KC139086.1-CNR12.m1-cds1KC139086.1-CNR12.m1-cds1Prunus aviumCDS
KC139086.1-CNR12.m1-cds2KC139086.1-CNR12.m1-cds2Prunus aviumCDS
KC139086.1-CNR12.m1-cds3KC139086.1-CNR12.m1-cds3Prunus aviumCDS
KC139086.1-CNR12.m1-cds4KC139086.1-CNR12.m1-cds4Prunus aviumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CNR12KC139086.1-CNR12.p1Prunus aviumpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KC139086 region KC139086:1492..4258+ NCBI Rosaceae gene and mRNA sequences
scaffold_2 supercontig scaffold_2:15647989..15650767+ Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Productcell number regulator 12
The following sequences are available for this feature:

mRNA sequence

>KC139086.1-CNR12.m1 ID=KC139086.1-CNR12.m1|Name=CNR12|organism=Prunus avium|type=mRNA|length=768bp
back to top

protein sequence of CNR12

>KC139086.1-CNR12.p1 ID=KC139086.1-CNR12.p1|Name=CNR12|organism=Prunus avium|type=polypeptide|length=255bp
back to top

mRNA from alignment at KC139086:1492..4258+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC139086.1-CNR12.m1 ID=KC139086.1-CNR12.m1|Name=CNR12|organism=Prunus avium|type=mRNA|length=2767bp|location=Sequence derived from alignment at KC139086:1492..4258+ (Prunus avium)
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaaca agaagcgccaacggaagatatcacccctggagagctcaaccaacccattc aaattcctcaggtccttctttcacttcctgggcttcgaattttttttgca gaaaatcgcaaatttgggttcatatctgagaaaaatgataatgttggatg ttggttttctgttgttttttgtgttttcttctatcttgttgcaaattagc ttctggtttgcttataattgatattcttagaaacctctcctctgttttta aattataagtgcaatgctaatgatatttctgacattgaggtgacatgttt tagtgtgcatttatctatgtgatgtacctcaatctaatgttgaaatattg tccttgttatgtttttttgttggtgttgatgattatgtttagtactggac agttaattgttgataagtgtgcggaatgtgggcaacccctgcctgaaaga taccaacccccagctgatgaagaatggacaactgggatatttggctgtgc tgaagatcctgggagttgtaagcgttcatctgctgtatcacttttcgttt tcttttttctcgggatgggaggcggtttgaaagcataattttctactttt gttgattaatcaggcgaggaaaaacagggttacatgtggcccacttatga tgattaataaggcaaagaaaaacaatgttaaaatgtgacctaatgatttg gaagttagacctttagattgtccaagttaagcaaaattgtttttttacgc aaccagttctcacctcagcaggtcagaaggctttgtgtatccaaatagga atagcattttggaaatttatgttactctcctagtttttacatattgtgtt ccttgctgagatcataatgtgcctagatttgtttggattttctgaagaaa aagagagaagatttttagattttagagtattagttgagtgagataaatta gatgtcactaccctgatggaatatattttatcacactttcctgatcattc aaaattccttgaatttattgtgtttatgttgcaggctggactggactttt ctgtccttgtgtgctgtttgggcgtaatgttgaaacaatacgagaagata ttccctggaacaatgcctgtgtttgccatgccatgtgtgttgaaggagga attgcagttgcagcagcaacaggattctttcatggtcttgatcctaagac ttcagttctcatctgtgagacattgctatttgcctggtggatgtgtgcaa tctacacaggtctgtttaggcagtcattgcaaaagaagtatcatctcaag gtgaatttcagttcctatatttcttgaaatgcaaaataaatcagatcatc tggaagaataggatgtgaataaatttctgaaatgtaaaaggcccgtgtac attcactttagataattttgtgttttctccaatttatttttgcatttttg gtaagttattttgttaaaaatttttccacatgattttgctttgtacgcaa atggcttttggtgataggccctacttttaataaggtgaagtttttcttgt ctcacatataatatatagcttctgatgtgaattttatgtcatactatgaa atgttgattcatgtgtttgactttcccgttcgagtgtgatgttcttttgt tgtgtgtgtgtaaaccagatggtttgtttgctaaattgcctttgcactat cctcagctggtcagcaaatcaattatctacattgtctgctataaagagct tttagatacaagattgttttttaatcagtgtttacttcgataattttatg tgttagtagcactgatgcttcagaaagagcagacttcatttattttcatt tatatgcttgaaattttatctttcttcaatacttccttctaaacttaagt aggataaaaataaataaaaattcatttgttaatcagtttcccagatagaa tgtgaaatggatgaatttgagcctttaagtgtatttgtttacttttctgc tatcaatatctagatttaagtctctctgatgtactagcattgcatgctga aaagatgtatctaaatcaaagacctaagtggtcatagaaagaagccatca acacattagttatcaaatggtttagatactccaatttttagagctaatac gggccccttgagacatgatatcacgggttcctgttttcaaaacctcaaga tttacagctttaaatttttggtggaaactcagaatattttgtttatgaaa gagtagcttgaggtttgtaacaattgctttcagaaaaaagtaatttagtg ttagcttttattatggaaagaaagccctgaaatctgtttcccttcctgaa aaagctaatgaactcttttaggattatttcatttgaacattaacacctat agtggtgatgggttctgacttagtgtgctacttttctgcaggattcaccc tgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtca agagcacagggagatgaggaaccacctatctgataatacttccaatacga tgacccttgttgcccctccaccagttcaagagatgaactctggagagaac aaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgc tgcttcgtctgcagagtcttctgatcataaaaacaccaatatggagttgg ccctgcagcctgtgtag
back to top

Coding sequence (CDS) from alignment at KC139086:1492..4258+

>KC139086.1-CNR12.m1 ID=KC139086.1-CNR12.m1|Name=CNR12|organism=Prunus avium|type=CDS|length=768bp|location=Sequence derived from alignment at KC139086:1492..4258+ (Prunus avium)
back to top