RPL5, RPL5 (gene) Malus x domestica

Gene Overview
Name RPL5
Gene Symbol RPL5
Type gene
Organism Malus x domestica
Synonym ribosomal protein L5
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RPL5AB674549.1-RPL5Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RPL5AB674549.1-RPL5.m3Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ribosomal proteinRPLMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB674549.1-RPL5 N/A AB674549.1
mRNA parsed from NCBI nr database AB674549.1-RPL5.m3 N/A AB674549.1

Sequence(s):
>AB674549.1-RPL5558
atgtttccactcaattttcattacgaagatgtattacgtcaggatccgttgctcaaactgaatcacgctaacgttatgga
agttcctggatcgtgtgaaataagagttttaccaaaggcaccctatgatttcataataaaaaatggaaaattggctatgg
agattccgcgcggtcagaaattcatacagacaaaaaggggttcgacaggaaagtcgtttcgatccaatccattcttgggg
tcaaataaagacaaaggatatgccagtgacctagcacgacaaagcactctccgagggcatggaatgtctaatttttcggt
cagaatctcgacagtaatgtctctgttagattccccggtcgaaatacgggaaaacttcattcaattctcgatggaaacgg
agttttgcgaattctccccggaactggaagatcatttcgagatcttcgagcatattcgagggttcaatgtgactattgtc
acttcggccaacacgcaagatgagactttaccaccgtggagcggctttttgcaaaaagatgagggggaaactccgtaa
back to top
>AB674549.1-RPL5.m3558
atgtttccactcaattttcattacgaagatgtattacgtcaggatccgttgctcaaactgaatcacgctaacgttatgga
agttcctggatcgtgtgaaataagagttttaccaaaggcaccctatgatttcataataaaaaatggaaaattggctatgg
agattccgcgcggtcagaaattcatacagacaaaaaggggttcgacaggaaagtcgtttcgatccaatccattcttgggg
tcaaataaagacaaaggatatgccagtgacctagcacgacaaagcactctccgagggcatggaatgtctaatttttcggt
cagaatctcgacagtaatgtctctgttagattccccggtcgaaatacgggaaaacttcattcaattctcgatggaaacgg
agttttgcgaattctccccggaactggaagatcatttcgagatcttcgagcatattcgagggttcaatgtgactattgtc
acttcggccaacacgcaagatgagactttaccaccgtggagcggctttttgcaaaaagatgagggggaaactccgtaa
back to top