S-RNase, S-RNase (gene) Amygdalus nairica

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Amygdalus nairica
Synonym NA
Description NA
Comment ribonuclease S11; coding region not determined; contains first and second intron
ribonuclease S11; coding region not determined; contains second intron
ribonuclease S1; coding region not determined; contains second intron
ribonuclease S9; coding region not determined; contains first intron
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseHM003205.1-S-RNaseAmygdalus nairicagene
S-RNaseHM003201.1-S-RNaseAmygdalus nairicagene
S-RNaseHM003198.1-S-RNaseAmygdalus nairicagene
S-RNaseHM003180.1-S-RNaseAmygdalus nairicagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseAmygdalus nairicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM003205.1-S-RNase N/A HM003205.1
gene parsed from NCBI nr database HM003201.1-S-RNase N/A HM003201.1
gene parsed from NCBI nr database HM003198.1-S-RNase N/A HM003198.1
gene parsed from NCBI nr database HM003180.1-S-RNase N/A HM003180.1

Sequence(s):
>HM003205.1-S-RNase866
mcttgttcttgstttygctttcttctttgttgtgagcagtggtgggttgcattacaatcttttgctatatcctatatgca
gataatcagcattgcaagtttttttttttttttttttttttttttttttttttttgtgaacagcattgcatttttcactt
atattttttgttcagagaactattgtgtgtattcgatgatatatcacatgacatgcggtatattgaattcacccacatat
ttttcatttaatctaacgcacaactttctttggatgagtaagtacttggggattgtttttctgcatgtcctcttttttat
tttcatcctcttttgttctatctgataattgttgcaataagtgcagtctattcatcacaataatttggcaggatcttcan
tttgtycaacantggcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcaccatccatggcctatgggaagcccagtaattgcaacgggtc
aaaatatgaggacaggaaagtggtaggtcataaattttttactttctctctagtttttagaaaattaaattgtcaagtga
agataataactaccaaaatatgaaaacctatctatccctttttwccmccccmccccccccccaaaaaaaaaaatcaaact
atcccttaaggttattctttttctgaaaatatgtctacattgtttgcatgtctcagtaccctaaattgcgatccaaactg
aagagatcttggcccgacgtggaaagtggcaatgatacaagattgaatggaacaarcayggyaswt
back to top
>HM003201.1-S-RNase357
tcaccatccatggcctatggcaagaagcccagtaattgcaacgggtcaaaatatgaggacaggaaagtggtaggtcataa
attttttactttctctctagtttttagaaaattaaattgtcaagtgaagataataactaccaaaatatgaaaacctatct
atccctttttaccaaaaccccccaccaaaaaaaaaaaaaaaatcaaactatcccttataaggttattctttttctgaaaa
atatgtctacattgtttgcatgtctcagtaccctaaattgcgatccaaactgaagagatcttggcccgacgtggaaagtg
gcaatgatacaagatgaatggaacaarcayggyaswt
back to top
>HM003198.1-S-RNase674
tcaccattcatggcctatggccaagtaattattcaaacccaaggatgcccagtaattgcagggggtcgctatttgagaca
aggaaattggtatgcattgtttcatttatttgttttttcacttactctttagtatttagttttcagaaaatgagattgtc
atatgaagttgttttttttccccaataaatcttgggtattagataaaattttgatgtcggtctgttctgcaaattatttt
gataatatacctaactacaaaattgtaaataaatttatattagtagcctgtaggtgtatacatagatacattaatgtatc
aagtaaaatgaagcgattatgttttgaatatttttcttaaattagggaaatatgtataatgattctgctcatctaattaa
aggacatgctttctggcataaaaaatataataaggataggctattttgtttatatcgataatttacctatcctttaatac
tcaagtttaacgaaaaaagaagtcttataaaaaaattgaaaatctcactactccttaagtttgtacctcttctttttctc
aaaatttgtctacattgcggatgtcagtcccctgaattgmaatccaamctgamgagatcttggcccaacgtggaaaccga
caatgatacaaagaatggaacaarcayggyaswt
back to top
>HM003180.1-S-RNase323
mcttgttcttgstttygctttcttctgtgtttcattatgagcactggtgggttgcattacaatcttttgccctttatatc
atgcatataattagcattgtaattttttacttatattttatgtttagacaagtattgtgtacgttcgataatatatcaag
taacggaggacttgatctagcccacaacttcctttggatgagtaactatttggggataaatttctgcatgttttctttat
acatccttattaagataccattaaccttctcacaatatttttggcaggatcttatgtctattttcaatttgtncaacaat
ggc
back to top