S-RNase, S-RNase (gene) Malus hupehensis

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Malus hupehensis
Synonym self-incompatibility ribonuclease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468724.1-S-RNaseMalus hupehensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468724.1-S-RNase.m1Malus hupehensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus hupehensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KF468724.1-S-RNase N/A KF468724.1
mRNA parsed from NCBI nr database KF468724.1-S-RNase.m1 N/A KF468724.1

Sequence(s):
>KF468724.1-S-RNase664
atgggttttacgggaatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactttactgctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacgcgaagggaaatgacccagaaggttgcaagacacagaaatat
cagaaggtgtgtttatctcatttaagtacttgtgtgtacaaatattacaattaattaaaaccaaatttgtacattaaagg
atgtgtcaccatattaaaaaacacttaactaataagccaattatcaataatcacatctggcttacaaaatttagtttaaa
attttagtcactctagcattatgctaatttgaaacttaatcataattttttttctgttgtatattattatattgtcagat
gcaaatactcgaaccccagttggaaattatttggccgaacgtatacaatcgaaccgccaatgaagtcttctggcgtaaac
agtggtataaacatggctcctgtgcgtctcccccattacagaaccagacgcattactttgaaacagtaatcaaaatgtac
agaacccagaaacaaaacgtctct
back to top
>KF468724.1-S-RNase.m1432
atgggttttacgggaatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactttactgctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacgcgaagggaaatgacccagaaggttgcaagacacagaaatat
cagaagatgcaaatactcgaaccccagttggaaattatttggccgaacgtatacaatcgaaccgccaatgaagtcttctg
gcgtaaacagtggtataaacatggctcctgtgcgtctcccccattacagaaccagacgcattactttgaaacagtaatca
aaatgtacagaacccagaaacaaaacgtctct
back to top