S-RNase, S-RNase (gene) Malus kansuensis

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Malus kansuensis
Synonym self-incompatibility ribonuclease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468729.1-S-RNaseMalus kansuensisgene
S-RNaseKF468726.1-S-RNaseMalus kansuensisgene
S-RNaseKF468725.1-S-RNaseMalus kansuensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468729.1-S-RNase.m1Malus kansuensismRNA
S-RNaseKF468726.1-S-RNase.m1Malus kansuensismRNA
S-RNaseKF468725.1-S-RNase.m1Malus kansuensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus kansuensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KF468729.1-S-RNase N/A KF468729.1
gene parsed from NCBI nr database KF468726.1-S-RNase N/A KF468726.1
gene parsed from NCBI nr database KF468725.1-S-RNase N/A KF468725.1
mRNA parsed from NCBI nr database KF468729.1-S-RNase.m1 N/A KF468729.1
mRNA parsed from NCBI nr database KF468726.1-S-RNase.m1 N/A KF468726.1
mRNA parsed from NCBI nr database KF468725.1-S-RNase.m1 N/A KF468725.1

Sequence(s):
>KF468729.1-S-RNase1151
atggggattacgaggatgacatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacgacggg
atacgattattttcaatttacgcagcaatatcaactggctgcctgcaactctaatcctactccttgtaaggatcctcctg
agaaattgtttacggttcacggtttgtggccttcaaactctaatggacctgacccagtaaactgcaagccgaaaaccaag
gtgcctcaggtgccccagccggtaatatatctgaaaatttaactttccccctctgaacacattttttctagcctataacc
catcatatttattgcaataaaaaccaataatcaaaatccaactaaacaacttaccaaattagtttgtgtgtcattttttt
atattttttgaatctctaatataccctcatctaagctagtatggaaagctcttataattatgttttaattgatgacgtgc
atccaatttggcaaggtattgtagccaataaatctagttataaatgtaggaattaatttggaaatatttttcatttcaac
aataaatttcaatttgaatatacctaattttaaggtttaatttcaacaatatatattgtttaattttttatgaaaataat
gtacctatctttgaatttttacaaagttaatgtagctactttttaaatttttaacaaaactaatttacctacttcttttt
atagtattagtatacataatatgtagaacatgtgtccgtatatatttgatctaattcggttttggattggggggagttca
cacaaaattaaaatatattaaacaaattaaatgtctgaaaaaatgtataacaaattaaatatcttattcaaattttgagt
tttatttagaagtcaacatacatgtgtccttttgtctagaagttatcataaattttttctattgtatattttattttgtc
agatagatgcatcactcaaaccccagttggaaattatttggccgaacgtattcaatcgagccgataatgaaagcttctgg
aataaacagtgggacaaacatggcacctgtgggtctcccacaataaaagacaagaaccattactttcaaacagtaatcaa
aatgtacataacccagaaacaaaacgtctct
back to top
>KF468726.1-S-RNase1178
atggggattacgaggatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacgatggg
atacgatcattttcaatttacgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaaggatcctcctg
agaaattgtttacggttcacggtttgtggccttcaaattctaatggacctgacccagtaaactgcaagccaaaaaccaag
gtgcctcaggcgcagcagccggtaatttatctgaaaatttaactttccccctctaaacacattttttctagcctataatc
catcatatcatatttatcgcaataaaacccagtaatcagaatccaactaaacaacttaccaaattagtttgtgtgtcatt
tttttatatttttaaaatctctaatatgccctcatctaagccaatatggaaagctcttgtaattaagttttaattgatga
cgtgcatccaatttggaaatatttttcatttcaacaataaaattcaatttgaatatacctaattttaaggtttaatttca
acaatatatattgtttaattttataaaaataacatagctactatgaaacttacctacggtttatttttttatgaaaatat
tgtacctatctttgaatttttacaaagttaatgtatctgcttttttaatttttaacaaaactaatttacctacttctttt
tatagtattagtatacataatatgtagaacatatgtccgtatatatttgatctaattctgtcttggattgggcgagttca
cacaaaatgaaaatatattaaacaaactaaatctctgaaaaaacgtataagagatatggtggcctgattttataaataaa
caggaattcatggacatcttattcaatttttttagaagtcatcatacatgtgggcttttgtctagaagttatcataaatt
tttttctattgtatatttgatgttgtcagatagatgcatcactcaaaccccagttggaaattatttggccgaacgtattc
aatcgagccgataatgaaagcttctggaataaacagtgggacaaacatggcacctgtgggtctcccacaataaaagacaa
gaaccattactttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468725.1-S-RNase575
atggggattacgaggatgatatacatggttacgatgttattttcattacttgtatcaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactg
acaagttgtttacggttcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgt
cggaaggtaatattattagtgatcagatagtcaatattgtttatttcatttatataattgtgtgtgtgtgtatacataat
ttttcttatacaattaatttaaaatttaatcataaattttttatgttgtacatattatgttgtcagagagcaaaaacact
cgaaccccagttggaaattatttggccgaacgtcctcgatcgaaccaatcatacaggcttctggcgtagacagtggaaaa
aacatggcacctgtgggtatcccacaatacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgag
aaacaaaacgtctct
back to top
>KF468729.1-S-RNase.m1450
atggggattacgaggatgacatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacgacggg
atacgattattttcaatttacgcagcaatatcaactggctgcctgcaactctaatcctactccttgtaaggatcctcctg
agaaattgtttacggttcacggtttgtggccttcaaactctaatggacctgacccagtaaactgcaagccgaaaaccaag
gtgcctcaggtgccccagccgatagatgcatcactcaaaccccagttggaaattatttggccgaacgtattcaatcgagc
cgataatgaaagcttctggaataaacagtgggacaaacatggcacctgtgggtctcccacaataaaagacaagaaccatt
actttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468726.1-S-RNase.m1450
atggggattacgaggatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacgatggg
atacgatcattttcaatttacgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaaggatcctcctg
agaaattgtttacggttcacggtttgtggccttcaaattctaatggacctgacccagtaaactgcaagccaaaaaccaag
gtgcctcaggcgcagcagccgatagatgcatcactcaaaccccagttggaaattatttggccgaacgtattcaatcgagc
cgataatgaaagcttctggaataaacagtgggacaaacatggcacctgtgggtctcccacaataaaagacaagaaccatt
actttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468725.1-S-RNase.m1435
atggggattacgaggatgatatacatggttacgatgttattttcattacttgtatcaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgcctgtaactctaatcccactccttgtaaggatcctactg
acaagttgtttacggttcatggtttgtggccttcaaacaaaataggacgtgacccagaatattgcaagacaaggaatcgt
cggaagagagcaaaaacactcgaaccccagttggaaattatttggccgaacgtcctcgatcgaaccaatcatacaggctt
ctggcgtagacagtggaaaaaacatggcacctgtgggtatcccacaatacagaacgagaatgattactttgaaacagtaa
tcaaaatgtacataaccgagaaacaaaacgtctct
back to top