S-RNase, S-RNase (gene) Malus prunifolia

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Malus prunifolia
Synonym self-incompatibility ribonuclease
S-RNase
mpS2-RNase
mpS1-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468737.1-S-RNaseMalus prunifoliagene
S-RNaseAB618797.1-S-RNaseMalus prunifoliagene
S-RNaseAB618796.1-S-RNaseMalus prunifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468737.1-S-RNase.m1Malus prunifoliamRNA
S-RNaseAB618797.1-S-RNase.m1Malus prunifoliamRNA
S-RNaseAB618796.1-S-RNase.m1Malus prunifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus prunifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KF468737.1-S-RNase N/A KF468737.1
gene parsed from NCBI nr database AB618797.1-S-RNase N/A AB618797.1
gene parsed from NCBI nr database AB618796.1-S-RNase N/A AB618796.1
mRNA parsed from NCBI nr database KF468737.1-S-RNase.m1 N/A KF468737.1
mRNA parsed from NCBI nr database AB618797.1-S-RNase.m1 N/A AB618797.1
mRNA parsed from NCBI nr database AB618796.1-S-RNase.m1 N/A AB618796.1

Sequence(s):
>KF468737.1-S-RNase606
atgggagttacggggatgatatatatgtttacaatggtattttcattaattgtattagtattgtctgcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaaggtaatattattaataatgagatagtcaatattgtttatttcatttatgcacgtgtgtatatatacatt
acatatactcaacatagattttcatgcacgcctgtgcaaatattacaattaatttaaaatttaatcatgaattgtttctg
ttatataattatattgtcagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgat
catgtaggcttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattattt
aaaaacagtaatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>AB618797.1-S-RNase613
ccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttacggttcacggtttgtggccttc
aaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatggtaatattattaataatcagat
agtcaatattgtttatttcatatatacatatactgaatgcagatttccatacacgcttgtgcaaatattacaattaattt
aaaatttaatcataatttttttttttgtattataaatgttatattatattgtcagctaaaaaatatccaagcccagttgg
aaattatttggccgaacgtactcaatcgaaccgatcatataggcttctgggaaagacaatggaaaaaacatggcagctgt
gggcgtcccgcaataacgaacgaggtggattactttcaaacagtaatcaaaatgtacataacccagaaacaaaatgtatc
caaaatcctcgcaaaagcgaagattgaaccagaggggcgaatcaggatgctgaaggatattgaagatgccatacgcaatg
gtaccaacaataagaaaccaaaactcaagtgccaaaagaatagtaggatgact
back to top
>AB618796.1-S-RNase601
ccggctgcctgcaactctaatcctactccttgtaatgatcctcctgacaagttgtttacggttcacggtttgtggccttc
aaacaaagtaggaggtgacccagaatactgcaagacaaggaatcatcggaaggtaatattattagtattcagatagtcaa
tattgtttatttcatttatatactcgtgtgtatgtgtgtgtatatatatattttttcttaatacaattaatttaaagatt
aatcataaattttttatattgtacatattctattgtcagagagcaaaaaaactggaaccccagttggagattatttggcc
gaacgtactcgatcgaaccaatcatacaggcttctggagtagacagtggacaaaacatggtacctgtgggtatcccacaa
tacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgagaaacaaaacgtctctcgaatcctctca
aatgcaaagattgaaccggatgggataagcagagcgctggtagacattcaaaatgccatacgcaacggtaccaacgataa
gataccaaaactcaagtgccaaaagaagaatagggtgactg
back to top
>KF468737.1-S-RNase.m1438
atgggagttacggggatgatatatatgtttacaatggtattttcattaattgtattagtattgtctgcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacaggaatggacctgacccagaaaaatgcaagactacaaccatg
aattctcagaagataggaaatatgacagcccagttggaaattatttggccgaacgttctcaatcgaagcgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgtgggtatcccacaataaaggacgacatgcattatttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>AB618797.1-S-RNase.m1456
ccggctgtctgcaactctaatcctaccccttgtaaagatcctcctgacaagttgtttacggttcacggtttgtggccttc
aaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtgacttctcatatgctaaaaaatatccaagcccagt
tggaaattatttggccgaacgtactcaatcgaaccgatcatataggcttctgggaaagacaatggaaaaaacatggcagc
tgtgggcgtcccgcaataacgaacgaggtggattactttcaaacagtaatcaaaatgtacataacccagaaacaaaatgt
atccaaaatcctcgcaaaagcgaagattgaaccagaggggcgaatcaggatgctgaaggatattgaagatgccatacgca
atggtaccaacaataagaaaccaaaactcaagtgccaaaagaatagtaggatgact
back to top
>AB618796.1-S-RNase.m1454
ccggctgcctgcaactctaatcctactccttgtaatgatcctcctgacaagttgtttacggttcacggtttgtggccttc
aaacaaagtaggaggtgacccagaatactgcaagacaaggaatcatcggaagagagcaaaaaaactggaaccccagttgg
agattatttggccgaacgtactcgatcgaaccaatcatacaggcttctggagtagacagtggacaaaacatggtacctgt
gggtatcccacaatacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgagaaacaaaacgtctc
tcgaatcctctcaaatgcaaagattgaaccggatgggataagcagagcgctggtagacattcaaaatgccatacgcaacg
gtaccaacgataagataccaaaactcaagtgccaaaagaagaatagggtgactg
back to top