S-RNase, S-RNase (gene) Malus sikkimensis

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Malus sikkimensis
Synonym self-incompatibility ribonuclease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468740.1-S-RNaseMalus sikkimensisgene
S-RNaseKF468730.1-S-RNaseMalus sikkimensisgene
S-RNaseKF468728.1-S-RNaseMalus sikkimensisgene
S-RNaseKF468727.1-S-RNaseMalus sikkimensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468740.1-S-RNase.m1Malus sikkimensismRNA
S-RNaseKF468730.1-S-RNase.m1Malus sikkimensismRNA
S-RNaseKF468728.1-S-RNase.m1Malus sikkimensismRNA
S-RNaseKF468727.1-S-RNase.m1Malus sikkimensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus sikkimensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KF468740.1-S-RNase N/A KF468740.1
gene parsed from NCBI nr database KF468730.1-S-RNase N/A KF468730.1
gene parsed from NCBI nr database KF468728.1-S-RNase N/A KF468728.1
gene parsed from NCBI nr database KF468727.1-S-RNase N/A KF468727.1
mRNA parsed from NCBI nr database KF468740.1-S-RNase.m1 N/A KF468740.1
mRNA parsed from NCBI nr database KF468730.1-S-RNase.m1 N/A KF468730.1
mRNA parsed from NCBI nr database KF468728.1-S-RNase.m1 N/A KF468728.1
mRNA parsed from NCBI nr database KF468727.1-S-RNase.m1 N/A KF468727.1

Sequence(s):
>KF468740.1-S-RNase609
atgtcgaggatggtatatgtggttacgatggtatttttattaattgtgttaatattgtcttcgtccacggtgggatacga
ttattttcaatttacgcagcaatatcagctggctgtctgcaactctaatcgtactctttgtaaggatcctcctgacaagt
tgttcacggttcacggtttgtggccttcaagcatggtaggacctgacccaagtaaatgcccgataaagaatattcggaag
gtaatattattagtaatccaatcgtcaatattgtttatttcatttatgtacttgtgtgtgtgtttgtgtatattcaatat
atacatactcaaacatagattttcatgcacatgtgtacaaatattacaattagttcaaaatataatcataaatttttttt
ttttctattctgcataccagagagaaaaattactcgaaccccagctggaaattatttggccgaacgtattcgatcgaacc
aaaaataacctgttctgggataaagagtggatgaaacatggctcctgtgggtatcccacaatagataacgagaaccacta
ctttgaaaccgtaatcaaaatgtacatcaccaagaaacaaaacgtctct
back to top
>KF468730.1-S-RNase189
atggggattacggggatgatatatatggttaagatggtattttcattaattgtattaatattgtcttcgtccacggcgaa
atacgattattttaaatttacgcagcaatatcagcacgctgtctgcaactctaatcctactccttgtaacgatcctcctg
acaagttgtttacggttcacggcttgtga
back to top
>KF468728.1-S-RNase607
atgggaattacggggatgatatatatgtttacaatggtattttcattaatagtattaatattgtcttcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctcctg
aaaaattgtttacggttcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatg
aattctcagaaggtaatattattaataatgagatagtcaatattgtttatttcatttatgtacttgtgtataaaatatat
tacatatactcaacatagattttcatgcacgcctgtggaaatattacaattaatttaaaatttaatcatgaattgtttct
attatataattatattgtcagataggaaatatggcagcccagttggaaattatttggccgaacgtactcaatcgaactga
tcatgtaggcttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattact
taaaaacagtaatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468727.1-S-RNase63
atggggattacggggatgatatatgtggttacgatggtatttttattaatagtgttaatatag
back to top
>KF468740.1-S-RNase.m1429
atgtcgaggatggtatatgtggttacgatggtatttttattaattgtgttaatattgtcttcgtccacggtgggatacga
ttattttcaatttacgcagcaatatcagctggctgtctgcaactctaatcgtactctttgtaaggatcctcctgacaagt
tgttcacggttcacggtttgtggccttcaagcatggtaggacctgacccaagtaaatgcccgataaagaatattcggaag
agagaaaaattactcgaaccccagctggaaattatttggccgaacgtattcgatcgaaccaaaaataacctgttctggga
taaagagtggatgaaacatggctcctgtgggtatcccacaatagataacgagaaccactactttgaaaccgtaatcaaaa
tgtacatcaccaagaaacaaaacgtctct
back to top
>KF468730.1-S-RNase.m1189
atggggattacggggatgatatatatggttaagatggtattttcattaattgtattaatattgtcttcgtccacggcgaa
atacgattattttaaatttacgcagcaatatcagcacgctgtctgcaactctaatcctactccttgtaacgatcctcctg
acaagttgtttacggttcacggcttgtga
back to top
>KF468728.1-S-RNase.m1438
atgggaattacggggatgatatatatgtttacaatggtattttcattaatagtattaatattgtcttcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctcctg
aaaaattgtttacggttcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatg
aattctcagaagataggaaatatggcagcccagttggaaattatttggccgaacgtactcaatcgaactgatcatgtagg
cttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattacttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468727.1-S-RNase.m163
atggggattacggggatgatatatgtggttacgatggtatttttattaatagtgttaatatag
back to top