S-RNase, S-RNase (gene) Malus spectabilis

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Malus spectabilis
Synonym self-incompatibility ribonuclease
self-incompatibility ribonuclease S5
self-incompatibility ribonuclease S4
self-incompatibility ribonuclease S3
self-incompatibility ribonuclease S2
self-incompatibility ribonuclease S1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468736.1-S-RNaseMalus spectabilisgene
S-RNaseKF468735.1-S-RNaseMalus spectabilisgene
S-RNaseKF468734.1-S-RNaseMalus spectabilisgene
S-RNaseKF468733.1-S-RNaseMalus spectabilisgene
S-RNaseFJ943273.1-S-RNaseMalus spectabilisgene
S-RNaseFJ943271.1-S-RNaseMalus spectabilisgene
S-RNaseFJ943269.1-S-RNaseMalus spectabilisgene
S-RNaseFJ943267.1-S-RNaseMalus spectabilisgene
S-RNaseFJ943265.1-S-RNaseMalus spectabilisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468736.1-S-RNase.m1Malus spectabilismRNA
S-RNaseKF468735.1-S-RNase.m1Malus spectabilismRNA
S-RNaseKF468734.1-S-RNase.m1Malus spectabilismRNA
S-RNaseKF468733.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943273.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943272.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943271.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943270.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943269.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943268.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943267.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943266.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943265.1-S-RNase.m1Malus spectabilismRNA
S-RNaseFJ943264.1-S-RNase.m1Malus spectabilismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus spectabilisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KF468736.1-S-RNase N/A KF468736.1
predicted genes from whole genome assembly KF468735.1-S-RNase Chr17:31239242..31240970
unanchored:31130008..31131739
KF468735.1
gene parsed from NCBI nr database KF468734.1-S-RNase N/A KF468734.1
gene parsed from NCBI nr database KF468733.1-S-RNase N/A KF468733.1
gene parsed from NCBI nr database FJ943273.1-S-RNase N/A FJ943273.1
gene parsed from NCBI nr database FJ943271.1-S-RNase N/A FJ943271.1
gene parsed from NCBI nr database FJ943269.1-S-RNase N/A FJ943269.1
gene parsed from NCBI nr database FJ943267.1-S-RNase N/A FJ943267.1
gene parsed from NCBI nr database FJ943265.1-S-RNase N/A FJ943265.1
mRNA parsed from NCBI nr database KF468736.1-S-RNase.m1 N/A KF468736.1
predicted genes from whole genome assembly KF468735.1-S-RNase.m1 Chr17:31239242..31240970
unanchored:31130008..31131739
KF468735.1
mRNA parsed from NCBI nr database KF468734.1-S-RNase.m1 N/A KF468734.1
mRNA parsed from NCBI nr database KF468733.1-S-RNase.m1 N/A KF468733.1
mRNA parsed from NCBI nr database FJ943273.1-S-RNase.m1 N/A FJ943273.1
mRNA parsed from NCBI nr database FJ943272.1-S-RNase.m1 N/A FJ943272.1
mRNA parsed from NCBI nr database FJ943271.1-S-RNase.m1 N/A FJ943271.1
mRNA parsed from NCBI nr database FJ943270.1-S-RNase.m1 N/A FJ943270.1
mRNA parsed from NCBI nr database FJ943269.1-S-RNase.m1 N/A FJ943269.1
mRNA parsed from NCBI nr database FJ943268.1-S-RNase.m1 N/A FJ943268.1
mRNA parsed from NCBI nr database FJ943267.1-S-RNase.m1 N/A FJ943267.1
mRNA parsed from NCBI nr database FJ943266.1-S-RNase.m1 N/A FJ943266.1
mRNA parsed from NCBI nr database FJ943265.1-S-RNase.m1 N/A FJ943265.1
mRNA parsed from NCBI nr database FJ943264.1-S-RNase.m1 N/A FJ943264.1

Sequence(s):
>KF468736.1-S-RNase598
atggggattacggggataacatatgtggttacgatggtattttcattaattgtattaatattgtcttcgtacacggcggg
atatgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtg
acttctcatatggtaatattattaataatcagatagtcaatattgtttatttcatatatacatatactgaatgcagattt
ccatacacgcttgtgcaaatgttacaattaatttaaaatttaatcataattttttttttttttgtattataaatgttata
ttatattgtcagctaaaaaatatccaagcccagttggaaattatttggccgaacgtactcaatcgaacagatcatatagg
cttctgggaaagacaatggaaaaaacatggcagctgtgggcgtcccgcaataacgaacgaggtggattactttcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468735.1-S-RNase1566
atggggattacggggatgatatatatggttacaatggtattttcattaattgtattaatattgtcttcgtccgcggtgaa
attcgattattttcaatttacgcagcaatatcagccggctgtctgcagctctaatcctagtccttgtaaggatcctcctg
acaagttgtttacggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaaactacaatcttg
aaccctcaaacggtaatattattcaggcaaaattaatatccagtacttagttataatgttcattaattaagaccttatta
gttttcagattttgatcgatgtccctagcaaattcaaatgtcaattacataatatttttaaataaaaattagtaattgaa
acttacacccttatgaataagtttgtgcccattaattttcaattcaaaacttacatccttattaaactcctaactaattt
tcaattcaaaacatttccaaaaactaaaaattagaataagtttgtacccattaattttttataaaatgattttcaatttt
ttaatcttaaatgtagccattcatataatcctacatttacccattcttaaatataccattttgttatgtaaaatgtaccc
tttttaaaatataaatgtaacccttgtttatataaaatacattcaattttttttttctaaaccatatattttaaattatc
catttttaatataaaacgtaaccattttttatattaaatcaattcaaatttttttttcgaatccattttttaaacttata
tgggtacattctatttcgttgatttgagagtctatcgataccaagtttaatggaagaaatttaataatgtaagcctaata
cctcttttttttctttcaaaaatctacccatgtttgatacaataattttttgttagttttaatgaacgtacccatgtttt
cttatatatatatatgcatgcatgtatgtatgtatatatatatataacatattggagggcataatttactttaaattttt
taatcctataaatggattttatttaaaatctcattgatataaacaaccataaattttaatttttcatttaaaattataat
aatctacataaaatacattattatattaatgtcagaaactttgatcaaaaactgaaaatgagtaagatttcaattaaaga
acattgattattagtactatgtccaaaatctccctattattcataattagatggtcaaattgtttatcttttcatatata
cacatgctcgacatagattttcatgcactcgtgaaaaatattactattaatttaaaatttaatcataatttttttttcta
ttataatattgtattgtcagataacaaatcttacagcccagctggaaattatttggccaaacgtactcaatcgaaaggct
catgcacgcttctggcgtaaacagtggcgtaaacatggcacctgtgggtaccccacaatagcggacgacatgcattactt
tagcacagtaatcgaaatgtacataaccaagaaacaaaacgtctct
back to top
>KF468734.1-S-RNase526
cgattattttcaatttacgcagcaatatcagctggctgtctgcaactctaatcgtgctccttgtaaggatcctcctgaca
agttgtttacggttcacggtttgtggccttcaagcatggtaggacctgacccaagtaattgctcgataaggaatattcgg
aaggtaatattattagtatcagatcgtcaatattgtttatttcatttatgtacttgtgtgtgtgtatgtatattcaatat
atacatactcaaacatagattttcatgcacgtgtgtacaaatattacaattagtttaaaatataatcataattttttttt
tctattgtgcataccagagagaaaaattactcgaaccccagctggcaattatttggccgaacgtattcgatcgaaccaaa
aataaactcttctgggataaagagtggatgaaacatggcacctgtgggtatcccacaataaacaacgagaaccattactt
tgaaaccgtaatcaaaatgtacatcaccaagaaacaaaacgtctct
back to top
>KF468733.1-S-RNase776
atggggattaccgggatgatatatatggttatgatggtattttcactaattttattaatattgccttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctg
acaagttgtttaccgttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatat
catacggtaatattattagcataatcagatagtcaatattatttctctcatttatgtacttgtgtgtgtgtatatatata
tttttggataatgctaaagtcaccaagtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatcaacact
taaataataattcaatcatcaacatctacatcatttgattacaaaaaagtttgtcttcctagcattactctatatttttt
ttatatatacatatactcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaaaatttaatcataaat
tatttctattatatattattatattgtcagataaaaatgctcgaaccccagttggtaattatttggccgaacgtactcaa
tcgaaacgatcatgaaggcttctggcgtaaacagtgggataaacatggctcttgtgcgtcttccccaatacagaaccaga
agcattactttgatacagtaatcaaaatgtacacaacccagaaacaaaacgtctct
back to top
>FJ943273.1-S-RNase440
atggggattacggggatggtatacatggttacgatggtattttctttaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaatgatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacaaagtaggaggtgacccagaatactgcaagacaaggaatcat
cggaaggtaatattattagtattcagatagtcaatattgtttatttcatttatatacttgtgtgtatgtgtgtgtgtata
tatattttttcttaatacaattaatttaaagattaatcataaattttttatattgtacatattctattgtcagagagcaa
aaaaactggaaccccagttggaaattatttggccgaacgt
back to top
>FJ943271.1-S-RNase350
tttacgcagcaatatcagccggctgtctgccgctctaatcctactccttgtaaggatcctcctgacaagctgtttacggt
tcacggtttgtggccttcaaacatgaatggacctgacccaaaggattgctcgactacacccctgaattctactaaggtaa
tattaataagatagttaatattgttatttcatttatctacttgtgtatatatacataggttttcatgtacgcgtgtgcat
atattacaattaatttaaaatttaatcataatttgtttctattatatatatatattatattatcagctaaaaaatatcaa
agcccagttggaaattatttggccgaacgt
back to top
>FJ943269.1-S-RNase434
tttacgcagcaatatcagccggctgtctgcaactctaatcctactccttgtaaggattctccagacaagttgtttacggt
tcacggcttgtggccctcaaactcgagtggacctcacccacataattgcacgaatacaaccgtgaaatctcagacggtaa
tattattgataatcagattgtcaatattgttagattagtcatcgatgagatttgaacccatgtcatcatgcaaagtttca
acatcttttcatcactgtagtaagggaccacttgcttatttcatatatacatatactcaacatagattttcatgcaagcg
tgtgcaaatattacaattaatttaaaatttaatcgtaattttttttctcttatttatattatattgtcagataagatcac
tcaaggcccagttggaaattatttggccgaacgt
back to top
>FJ943267.1-S-RNase521
atgggttttacgggaatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactttactgctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacgcgaagggaaatgacccagaaggttgcaagacacagaaatat
cagaaggtgtgtttatctcatttaagtacttgtgtgtacaaatattacaattaattaaaaccaaatttgtacattaaagg
atgtgtcaccatattaaaaaacacttaactaataagccaattatcaataatcacatctggcttacaaaatttagtttaaa
attttagtcactctagcattatgctaatttgaaacttaatcataatttttttctgttgtatattattatattgtcagatg
caaatactcgaaccccagttggaaattatttggccgaatgt
back to top
>FJ943265.1-S-RNase458
atggggattacggggatgatatatatagttacgatggtattttcattaattgtactaatattgtcttcctctacggtggg
atacgattattttcaatttacgcagcaatatcagccagctgtctgcagatctaatcctactccttgtaaggatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacttcaatggacctcacccagcaaattgcacgaatgctaccgtg
aattctcacagggtaatattactgataatcagatcgtcactattgtttatttcatttatgtacttgtgtatatataaata
tactcaacatagattttcatgcacgcgtgtgcaaatattacaataaatttaaatttaatcataaatctacctatattata
tattatattgtcagataaaaaatatccaagcccagttgaaaattatttggccgaacgt
back to top
>KF468736.1-S-RNase.m1438
atggggattacggggataacatatgtggttacgatggtattttcattaattgtattaatattgtcttcgtacacggcggg
atatgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatcctaccccttgtaaagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaactcaacaggacgtgacccaaaatattgcaatccatcaaacgtg
acttctcatatgctaaaaaatatccaagcccagttggaaattatttggccgaacgtactcaatcgaacagatcatatagg
cttctgggaaagacaatggaaaaaacatggcagctgtgggcgtcccgcaataacgaacgaggtggattactttcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468735.1-S-RNase.m1438
atggggattacggggatgatatatatggttacaatggtattttcattaattgtattaatattgtcttcgtccgcggtgaa
attcgattattttcaatttacgcagcaatatcagccggctgtctgcagctctaatcctagtccttgtaaggatcctcctg
acaagttgtttacggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaaactacaatcttg
aaccctcaaacgataacaaatcttacagcccagctggaaattatttggccaaacgtactcaatcgaaaggctcatgcacg
cttctggcgtaaacagtggcgtaaacatggcacctgtgggtaccccacaatagcggacgacatgcattactttagcacag
taatcgaaatgtacataaccaagaaacaaaacgtctct
back to top
>KF468734.1-S-RNase.m1352
cgattattttcaatttacgcagcaatatcagctggctgtctgcaactctaatcgtgctccttgtaaggatcctcctgaca
agttgtttacggttcacggtttgtggccttcaagcatggtaggacctgacccaagtaattgctcgataaggaatattcgg
aagagagaaaaattactcgaaccccagctggcaattatttggccgaacgtattcgatcgaaccaaaaataaactcttctg
ggataaagagtggatgaaacatggcacctgtgggtatcccacaataaacaacgagaaccattactttgaaaccgtaatca
aaatgtacatcaccaagaaacaaaacgtctct
back to top
>KF468733.1-S-RNase.m1432
atggggattaccgggatgatatatatggttatgatggtattttcactaattttattaatattgccttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctg
acaagttgtttaccgttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatat
catacgataaaaatgctcgaaccccagttggtaattatttggccgaacgtactcaatcgaaacgatcatgaaggcttctg
gcgtaaacagtgggataaacatggctcttgtgcgtcttccccaatacagaaccagaagcattactttgatacagtaatca
aaatgtacacaacccagaaacaaaacgtctct
back to top
>FJ943273.1-S-RNase.m1291
atggggattacggggatggtatacatggttacgatggtattttctttaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaatgatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacaaagtaggaggtgacccagaatactgcaagacaaggaatcat
cggaagagagcaaaaaaactggaaccccagttggaaattatttggccgaac
back to top
>FJ943272.1-S-RNase.m1684
atggggattacggggatggtatacatggttacgatggtattttctttaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaatgatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacaaagtaggaggtgacccagaatactgcaagacaaggaatcat
cggaagagagcaaaaaaactggaaccccagttggagattatttggccgaacgtactcgatcgaaccaatcatacaggctt
ctggagtagacagtggacaaaacatggtacctgtgggtatcccacaatacagaacgagaatgattactttgaaacagtaa
tcaaaatgtacataaccgagaaacaaaacgtctctcgaatcctctcaaatgcaaagattgaaccggatgggataagcaga
gcgctggtagacattcaaaatgccatacgcaacggtaccaacgataagataccaaaactcaagtgccaaaagaagaatag
ggtgactgaattggttgagatcaccctttgcagcgataaaaacagagcacatttcattgattgccccaacccctttctac
ccggatcaccatatttatgccccaccaataatattcagtattaa
back to top
>FJ943271.1-S-RNase.m1198
tttacgcagcaatatcagccggctgtctgccgctctaatcctactccttgtaaggatcctcctgacaagctgtttacggt
tcacggtttgtggccttcaaacatgaatggacctgacccaaaggattgctcgactacacccctgaattctactaagctaa
aaaatatcaaagcccagttggaaattatttggccgaac
back to top
>FJ943270.1-S-RNase.m1684
atggggattacggggatgatatatatggttccgatggtattttcattaactgttctaatattgcctttgtccaccgtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgccgctctaatcctactccttgtaaggatcctcctg
acaagctgtttacggttcacggtttgtggccttcaaacatgaatggacctgacccaaaggattgctcgactacacccctg
aattctactaagctaaaaaatatcaaagcccagttggaaattatttggccgaatgtactcaatcgaaacgatcatgtaac
cttctggggtaaacagtggaacaaacatggcagctgtgggcatcctgcaataacggacgaggtgaattactttcaaacag
taatcaaaatgtacacaactcagaaacaaaacgtctccgaaatcctctcaaaggctaagattgaaccggaggggaaaacc
agggaagtgaaggatattgaaaatgccatacgcaatggtaccaacaataagaaaccaaaattcaagtgccaaaagaataa
taggacgactgaattggttgaggtcactctttgcagcgatagcaacttaatgcagttcataaattgcccccgcccaattc
tacctggatcaccatatctctgccccgccaaagttccatactaa
back to top
>FJ943269.1-S-RNase.m1198
tttacgcagcaatatcagccggctgtctgcaactctaatcctactccttgtaaggattctccagacaagttgtttacggt
tcacggcttgtggccctcaaactcgagtggacctcacccacataattgcacgaatacaaccgtgaaatctcagacgataa
gatcactcaaggcccagttggaaattatttggccgaac
back to top
>FJ943268.1-S-RNase.m1687
atggggattacggggatgatatatatggttacgatggtattttcattaattgtattaatattgtcgtcgtccaaggcgca
gcaatacgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatcctactccttgtaaggattctc
cagacaagttgtttacggttcacggcttgtggccttcaaactcgagtggacctcacccacataattgcacgaatacaacc
gtgaaatctcagacgataagatcactcaaggcccagttggaaattatttggccgaacgtactcaatcgaaacgatcatgt
agggttctggagtagacagtgggccaaacatggcacctgtgcgtctcccgcattgaagagcgacatgcagtactttcaaa
cagtaatcaatatgtacacaacccagaaacaaaacgtctcaaaaatcctttcaagggcgaatattaaaccgaatgggaca
accaaggcactgacagatatccaaaatgccatacgcaatcgtaacaacaatatgatgccaaaactcaagtgcaaaaataa
ttctgggatacctgaattggttgaggtcagtttttgcggcgatagcaacttaacacagttcataaattgcccccacccat
ttttaccaggatcaccatatttctgccccggccatgttcagtattaa
back to top
>FJ943267.1-S-RNase.m1288
atgggttttacgggaatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactttactgctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacgcgaagggaaatgacccagaaggttgcaagacacagaaatat
cagaagatgcaaatactcgaaccccagttggaaattatttggccgaat
back to top
>FJ943266.1-S-RNase.m1681
atgggttttacgggaatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcgtccacggtggg
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactttactgctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacgcgaagggaaatgacccagaaggttgcaagacacagaaatat
cagaagatgcaaatactcgaaccccagttggaaattatttggccgaacgtatacaatcgaaccgccaatgaagtcttctg
gcgtaaacagtggtataaacatggctcctgtgcgtctcccccattacagaaccagacgcattactttgaaacagtaatca
aaatgtacagaacccagaaacaaaacgtctcttacatcctctcaaaggcgaatattgaaccgaagggggaaaaaaggaca
cgggtggacattgaaaatgccatacgtggtggtaccaacaatatggtaccaaaactcaagtgccaaacgaatggtaggat
gactgcattggttgaggtcactctttgcagcgatagcaacttaacgcagttcataaattgcccccgcccaattccaccag
gatcaccatatttatgccccaccaataatattcagtattaa
back to top
>FJ943265.1-S-RNase.m1294
atggggattacggggatgatatatatagttacgatggtattttcattaattgtactaatattgtcttcctctacggtggg
atacgattattttcaatttacgcagcaatatcagccagctgtctgcagatctaatcctactccttgtaaggatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacttcaatggacctcacccagcaaattgcacgaatgctaccgtg
aattctcacaggataaaaaatatccaagcccagttgaaaattatttggccgaac
back to top
>FJ943264.1-S-RNase.m1684
atggggattacggggatgatatatatagttacgatggtattttcattaattgtactaatattgtcttcctctacggtggg
atacgattattttcaatttacgcagcaatatcagccagctgtctgcagatctaatcctactccttgtaaggatcctactg
acaagttgtttacggttcacggtttgtggccttcaaacttcaatggacctcacccagcaaattgcacgaatgctaccgtg
aattctcacaggataaaaaatatccaagcccagttgaaaattatttggccgaacgtactcgatcgaaccaatcatttagg
cttctggaataaacagtggataaaacatggcagctgtgggaatcccccaataatgaacgacacgcattactttcaaacag
taatcaacatgtacataacccagaaacaaaacgtctctgaaatcctctcaagggcgaagattgaaccgttgggaatacaa
aggccactggtggatattgaaaaggccatacggaatagtatcaacaagaagaaaccaagattcaagtgccaaaataatgg
tggggtgactgaattggtcgagatcagtctttgcagcgatcgcagcttaacgcagttcagagattgcccccacccatttc
caccaggatcaccatatctctgccccgccgatattcagtattaa
back to top