S-RNase, S-RNase (gene) Malus toringoides

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Malus toringoides
Synonym self-incompatibility ribonuclease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468741.1-S-RNaseMalus toringoidesgene
S-RNaseKF468722.1-S-RNaseMalus toringoidesgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseKF468741.1-S-RNase.m1Malus toringoidesmRNA
S-RNaseKF468722.1-S-RNase.m1Malus toringoidesmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus toringoidesgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KF468741.1-S-RNase N/A KF468741.1
gene parsed from NCBI nr database KF468722.1-S-RNase N/A KF468722.1
mRNA parsed from NCBI nr database KF468741.1-S-RNase.m1 N/A KF468741.1
mRNA parsed from NCBI nr database KF468722.1-S-RNase.m1 N/A KF468722.1

Sequence(s):
>KF468741.1-S-RNase655
cgattattttcaatttacgcagcaatatcagcacgctgtctgcaactctaatcctactccttgtaacgatcctcctgaca
agttgtttacggttcacggcttgtggccttcaaactggagtggacctcagccagaaaattgcacgaatacaaccatgaat
tttcaaacggtaatattattgataattagatagtgaaaattgtttatttcttatatccatatgctcaacaaagattttta
tgtacgcgtgtgcaaatgtttcaattatattattatataattgtttatttcatagatttttatgctcaacatagattttt
aattatatattattatgctcaattataaagatttgtatgaaatatagatttttatgctcaattatattattatatattat
tacatagatttttatgctcaacatagatagtcaaaattgtttatttctattatattattatattgtcagataagtgcact
caaagcccagttggaaattatttggccgaacgtactcaatcgatccgatcatgtacggttctggcgtggacagtggggca
aacatggcacctgcgggtctcccgcaataaaaaccgacatgcagtactttcaaacagtaatcaaaatgtacatgacacag
aaacaaaacgtctct
back to top
>KF468722.1-S-RNase607
atggggattacggggatgatatatatgtttacaatggtattttcattaatagtattaatattgtcttcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctcctg
aaaaattgtttacggttcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatg
aattctcagaaggtaatattattaataatgagatagtcaatattgtttatttcatttatgtacttgtgtataaaatatat
cacatatactcaacatagattttcatgcacgcctgtggaaatattacaattaatttaaaatttaatcatgaattgtttct
attatataattatattgtcagataggaaatatggcagcccagttggaaattatttggccgaacgtactcaatcgaactga
tcatataggcttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattact
taaaaacagtaatcaaaatgtacataacccagaaacaaaacgtctct
back to top
>KF468741.1-S-RNase.m1355
cgattattttcaatttacgcagcaatatcagcacgctgtctgcaactctaatcctactccttgtaacgatcctcctgaca
agttgtttacggttcacggcttgtggccttcaaactggagtggacctcagccagaaaattgcacgaatacaaccatgaat
tttcaaacgataagtgcactcaaagcccagttggaaattatttggccgaacgtactcaatcgatccgatcatgtacggtt
ctggcgtggacagtggggcaaacatggcacctgcgggtctcccgcaataaaaaccgacatgcagtactttcaaacagtaa
tcaaaatgtacatgacacagaaacaaaacgtctct
back to top
>KF468722.1-S-RNase.m1438
atggggattacggggatgatatatatgtttacaatggtattttcattaatagtattaatattgtcttcgtccacggtggg
atacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctcctg
aaaaattgtttacggttcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatg
aattctcagaagataggaaatatggcagcccagttggaaattatttggccgaacgtactcaatcgaactgatcatatagg
cttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattacttaaaaacag
taatcaaaatgtacataacccagaaacaaaacgtctct
back to top