S-RNase, S-RNase (gene) Prunus carduchorum

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus carduchorum
Synonym NA
Description NA
Comment ribonuclease S1/S3; coding region not determined; contains first intron
ribonuclease S4; coding region not determined; contains first intron
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseHM003184.1-S-RNasePrunus carduchorumgene
S-RNaseHM003181.1-S-RNasePrunus carduchorumgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus carduchorumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM003184.1-S-RNase N/A HM003184.1
gene parsed from NCBI nr database HM003181.1-S-RNase N/A HM003181.1

Sequence(s):
>HM003184.1-S-RNase336
mcttgttcttgstttygctttcttcttttgttacgttatgagcagtggtgggttgcattacaatcttttgctctttatat
tctatatgcatataatcagcattgctttttttgttgagagaaactatattgtgtgtgttcgatcatatatatcacatgac
atgtgctattgaatccacccacatatttttcatttagcgcacaattttctttggatgatcgtaagtatttgaggattgct
tttcctgcatgttctctttttattttcatcctcatttctttattctgataattttggcaggatcttatgactattttcaa
tttgtncaacantggc
back to top
>HM003181.1-S-RNase418
mcttgttcttggtttngctttcttcttgtgtttcgttatgagcactggtgatggtgggttgcattacaatcttttgctct
attgcatatcatcagcattgtatttttctcttgtattttttgttcagagaaactattatgtgtgttggatgatataccac
atgacatgcggtgtattgaattcgccacttataatacttttcatttaccctagcgcacaactttctcaggatgagtaagt
atatatatattttttggtcaaggatgagtaagtatttggggattgttgttctgcattaattttttttattttcatcctcg
tttgtttattatgaaaattgttgtaataagtgcactctattcatcacaataatttttgcaggtatcttacgactatcttc
aatttgtncaacantggc
back to top