S-RNase, S-RNase (gene) Prunus domestica

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus domestica
Synonym self-incompatibility ribonuclease
Description preventing self-pollination
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseAM746948.1-S-RNasePrunus domesticagene
S-RNaseAM746947.1-S-RNasePrunus domesticagene
S-RNaseAM746946.1-S-RNasePrunus domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseAM746948.1-S-RNase.m1Prunus domesticamRNA
S-RNaseAM746947.1-S-RNase.m1Prunus domesticamRNA
S-RNaseAM746946.1-S-RNase.m1Prunus domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AM746948.1-S-RNase N/A AM746948.1
gene parsed from NCBI nr database AM746947.1-S-RNase N/A AM746947.1
gene parsed from NCBI nr database AM746946.1-S-RNase N/A AM746946.1
mRNA parsed from NCBI nr database AM746948.1-S-RNase.m1 N/A AM746948.1
mRNA parsed from NCBI nr database AM746947.1-S-RNase.m1 scaffold_6:26447039..26448273
AM746947.1
mRNA parsed from NCBI nr database AM746946.1-S-RNase.m1 N/A AM746946.1

Sequence(s):
>AM746948.1-S-RNase1365
acttgttcttggttttgctttcttcttttgttacgttatgagcagtggtgggttgcattacaatcttctgctctttaaat
cttatatgcatataatcagcattgcgtttttctacgagtatttttttgttcagaggaactgttgtgtgcgttcaatgata
tatcacatgaacatgccgtgtatcgaattcacccacatttttcatttaatctaacgcacaactttcttcggatgagtaag
tatttggggattgtattttgcatgtcctccttttattttcatcctctttacttttgtttattctgttctttattattgaa
atccttatttatggtggcattaacattctcacaataattttggcaggatcttatgactattttcaatttgtgcaacaatg
gccaccgaccaactgcagagttcgcaataaaccttgcaccaaaccccggccattacaaaacttcaccatccatggcctat
ggccaagtaattattcaaacccaaggatgcccagtaagtgcaccgggtcgctatttaactttaggaaagtggtatgtact
gtttctctttttcacttactgcatttagttcatgctcttgagtcgcaaacatcttgtaaaggacgattggttactaaatt
aaattaatactcattttagctcaacattttcttcatcatttgctgtgtacatattctcgttatctatatctcactaatta
aagctgttgacttgaaatcttttcttttatgatgggaagtgacatataaataaaagcaatacagattggaggtaaaatta
gataattgaaattacaataactaaaattaataaatttgctaatacagaatcgagaatgagaggaaataaatttgataata
ccactttctttttcacttactgcgtttgagagtactatcccttacgtttttaatttttctcaaagtatgtaaatatactg
tttttctatccattatgataaaataatccagtttatacttatatgtatatattgcttggttgcttggatgtctcagtacc
ctcaattgcgttccgatctgaagatatcttggcctgacgtggaaagtggcaatgatacaaggttttgggaaagcgaatgg
aacaaacatggtagatgttccgaagactcacttaaccaaatgcagtacttcgagcggtcgcacgcaatgtggatatcgta
caatatcacagagatccttaagaacgcttcaatcgtaccaagtgcgacacaaaactggacctactcggacatagtatcac
ccattaaaagagcaactaaaagaacacccctcctccgttgcaaatacgataagagcactcagctgttacatgaagtggta
ttttg
back to top
>AM746947.1-S-RNase1164
acttgttcttggtttcgctttcttcttttgttacgttatgagcagcggtgggttgtattacaacatttcttttgctcttt
atatcctatatgcatataatcagcattgcgttatacttttattctttattcatagaaactattgtgtgcgttatatatca
catgacatgcggtgtattgaattaacccacatatttttcatttaatctaacgcacaactttctttggatgagtaagtatt
tggggattgtttttccgtatgtcctctttttgttttcatcatcttttgtttattctgataattggttgcaataagtgcag
tctattcatcataataattttggcaggatcttatgactattttcaatttgtgcaacaatggccaccgactaactgcagag
ttcgcgtcaagcgaccttgctccaatccccggccattacaatatttcaccatccatggcctatggccaagtaattattca
aacccaaggatgcccagtaattgcacagggtcgcaatttaagaaacagaatttggtatgtatttttttcacttagttttt
agaaaattagattgttatctgaaaataatataaacttttgaataaattttgggtgttacataaaattttatgctggcaca
tattgtaaaaataaagttcgaggtacatttatatacgtattttataataatatatcgaatcatttaataaatggatttac
cactttgtactagggtatataatggacagatttaatgaaaaacagaagttcttatccaataatgaaaatctaactctccc
ttccgtttttacttttttctcctcagtacccttatatgcaatccaaactgaagatatcttggccggacgtggaaagtggg
aatgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttccgaacgaacacttaacctaatgcaatactt
ccagcgatcccacgcaatgtggaaatcacacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacac
aaacatggaagtactcggacatagaatcacccattaaaagagcaactaaaagaacacccgtccttcgttgcaaacgtgat
ccagtacaggcgaatactcagctgttacatgaagtggtattttg
back to top
>AM746946.1-S-RNase1148
tttcagtttgtgcaacagtggccaccgaccaactgcagagttcgcctcaagcgaccttgctccaaaccacgaccactaca
aaatttcaccatccatggcctttggcccagtaatttttcaaacccaacgaagcccagtaattgcaatgggtcaaaatatg
aggacaggaaagtggtatgtcattatttttttactttctctttagtttttagaaaattaaattgtcatgtgaagataata
aactttcaatgaatcttttgggtgttctaaaatttcgatgtcggtccttgttagacacattattttgaataaataactat
cacgtagatattatgatatcctccaattgaaggacctgctattattctgtatgtatatattcaaaatactataccaaaat
caaatcagaaaatgataaataaaaaagtcattcacacaaaacaaaatgttaaaatggtaaattggacaaattagtccagt
tattgtccgacaatgacatgaaatgactcttatgtcactctcaatgagtgactcaagagtttatttcatgtcacagtcct
acaaggactggaccagtttgtccaatttttgagggactaaaccattttgtctcgatacccttctattgtacttatatgat
aaagcccgggcccaaataaaaattcaatttagtaatcatagttaacgaagagaaaaacaattttatcaaataatgaaaat
ctatccctccctttttacccccaaaaaaaatatatatatcccttaaggttttgctttttctgaaaatatgtctacattgt
ttgcatgtcgcagtaccctaaattgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatgatacaagat
tttgggaaggcgaatggaacaaacatggcagatgttccgaacagatacttaaccaaatgcaatacttcgaggtatcccat
gacatgtggctgtcgtacaatattactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaacatggaccta
ctcggacatagtatcacccattaaagcagcaactaaacgaacacccctccttcgttgcaaaattgatacagcaactaata
ctgagctgttacatgaagtggtattttg
back to top
>AM746948.1-S-RNase.m1561
acttgttcttggttttgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaat
ggccaccgaccaactgcagagttcgcaataaaccttgcaccaaaccccggccattacaaaacttcaccatccatggccta
tggccaagtaattattcaaacccaaggatgcccagtaagtgcaccgggtcgctatttaactttaggaaagtgtaccctca
attgcgttccgatctgaagatatcttggcctgacgtggaaagtggcaatgatacaaggttttgggaaagcgaatggaaca
aacatggtagatgttccgaagactcacttaaccaaatgcagtacttcgagcggtcgcacgcaatgtggatatcgtacaat
atcacagagatccttaagaacgcttcaatcgtaccaagtgcgacacaaaactggacctactcggacatagtatcacccat
taaaagagcaactaaaagaacacccctcctccgttgcaaatacgataagagcactcagctgttacatgaagtggtatttt
g
back to top
>AM746947.1-S-RNase.m1573
acttgttcttggtttcgctttcttcttttgttacgttatgagcagcggatcttatgactattttcaatttgtgcaacaat
ggccaccgactaactgcagagttcgcgtcaagcgaccttgctccaatccccggccattacaatatttcaccatccatggc
ctatggccaagtaattattcaaacccaaggatgcccagtaattgcacagggtcgcaatttaagaaacagaatttgtaccc
ttatatgcaatccaaactgaagatatcttggccggacgtggaaagtgggaatgatacaaaattttgggaaggcgaatgga
acaaacatggtacatgttccgaacgaacacttaacctaatgcaatacttccagcgatcccacgcaatgtggaaatcacac
aatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagtactcggacatagaatcacc
cattaaaagagcaactaaaagaacacccgtccttcgttgcaaacgtgatccagtacaggcgaatactcagctgttacatg
aagtggtattttg
back to top
>AM746946.1-S-RNase.m1509
tttcagtttgtgcaacagtggccaccgaccaactgcagagttcgcctcaagcgaccttgctccaaaccacgaccactaca
aaatttcaccatccatggcctttggcccagtaatttttcaaacccaacgaagcccagtaattgcaatgggtcaaaatatg
aggacaggaaagtgtaccctaaattgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatgatacaaga
ttttgggaaggcgaatggaacaaacatggcagatgttccgaacagatacttaaccaaatgcaatacttcgaggtatccca
tgacatgtggctgtcgtacaatattactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaacatggacct
actcggacatagtatcacccattaaagcagcaactaaacgaacacccctccttcgttgcaaaattgatacagcaactaat
actgagctgttacatgaagtggtattttg
back to top