S-RNase, S-RNase (gene) Prunus fenzliana

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus fenzliana
Synonym NA
Description NA
Comment ribonuclease S57; coding region not determined; contains second intron
ribonuclease Sk; coding region not determined; contains first intron
ribonuclease S7; coding region not determined; contains first intron
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseHM003200.1-S-RNasePrunus fenzlianagene
S-RNaseHM003188.1-S-RNasePrunus fenzlianagene
S-RNaseHM003185.1-S-RNasePrunus fenzlianagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus fenzlianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM003200.1-S-RNase N/A HM003200.1
gene parsed from NCBI nr database HM003188.1-S-RNase N/A HM003188.1
gene parsed from NCBI nr database HM003185.1-S-RNase N/A HM003185.1

Sequence(s):
>HM003200.1-S-RNase459
tcacmatycatggcctatggttcaacccaaggaagcccagtaattgcatgggtcgcgatttaactttacgaaagtggtac
gtattgtgttttttaacttactctttagcatttagttctaaaaaattagattatcatgtgatgataatatactttcttgg
tagataaaattgtaatgttggttttctggttaggaacattattttgcatatgtacctaagtataaaattggaagtaaatt
gaaaggataaaaataaaaattcaatttaatactcccattttatccgataatgaaaatctatccctaatgtatttcctttt
ttttttttttttctttctaaaaatatgttatatatggcttggatgtctcagtaccctcaattgcgaaacaaactgaagat
atcttgagtccgacgtggaaggtggcaatgatacaaagaatggaacaarcayggyaswt
back to top
>HM003188.1-S-RNase193
mcttgttcttggtttygctttcttcttgtgtttcattatgagcactggtgggttgcattacaatctttttgctcgtcatt
tcaacctaaaactatgtactttatacaccaaatccttatttaagataccattaaccttctcacaataatttgcgcaggat
cttacgtgtattttcantttgtncaacantggc
back to top
>HM003185.1-S-RNase364
cttgttcttggtttngctttcttcttttgttacgttatgagcagtggtgggttaaattacaatcttttgctatatcctat
atgcatataatcagctttgcatttttctacttgtatttgttgttcagagaaactattgtgtgtattggatgatatatcac
atgacatgcggtgtattgaattaacccacatatttttcatttaatctaacgcacaactttctttggatgagtaagtattt
ggggattgtttttgttttcattatcttttgtttattctgataattggttgcaataagtgcagtctattcatcacaataat
tttggcaggatcttatgactattttcaatttgtncaacantggc
back to top