S-RNase, S-RNase (gene) Prunus haussknechtii

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus haussknechtii
Synonym NA
Description NA
Comment ribonuclease S51; coding region not determined; contains second intron
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseHM003197.1-S-RNasePrunus haussknechtiigene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus haussknechtiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM003197.1-S-RNase N/A HM003197.1

Sequence(s):
>HM003197.1-S-RNase613
tcaccattcatggcctatggccaagtaattattcaaacccaacgctgcccagtaattgcaatgggtctcaatttaaggag
ttggtatgtattgtttcatttttctttcacttactcttcagcatttagtttttagaaaattagatggtcataaaaaaaat
ataatatactttttcaattaatctttggttttttattataaaattttgatgtttgtcatcgggccaagatttcttcagtt
tatattattttgaatatatacctaaataagtacatatatatttttgggtatattaatgtgcctacgtatatatttacaat
aatggatccgaccattaaattaaatcacctaccattttgtacttgcgtatatgtttaaaatatctgtgtctaaaatattt
aaaatattaaaatcaaaattcaatttaatactcaagtttattgaaccaaaaaatattatccaaaagagtgaaaatctaac
tatcccttccgtttgtgcttttataaaaatatgtacatatcagtaccctaaatggcgatacaaactgaagaaatcttggc
ccgatgtggaaagtggcaatgatacaaaattgaatggaacaarcayggyaswt
back to top