S-RNase, S-RNase (gene) Prunus humilis

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus humilis
Synonym S-RNase
Description NA
Comment ribonuclease; self-incompatibility RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseEF653138.1-S-RNasePrunus humilisgene
S-RNaseEF653137.1-S-RNasePrunus humilisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseEF653138.1-S-RNase.m1Prunus humilismRNA
S-RNaseEF653137.1-S-RNase.m1Prunus humilismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus humilisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EF653138.1-S-RNase N/A EF653138.1
gene parsed from NCBI nr database EF653137.1-S-RNase N/A EF653137.1
mRNA parsed from NCBI nr database EF653138.1-S-RNase.m1 N/A EF653138.1
mRNA parsed from NCBI nr database EF653137.1-S-RNase.m1 N/A EF653137.1

Sequence(s):
>EF653138.1-S-RNase667
tcacaattcatggcctatggccaagtaattattcaaatccaacgaagcccagcaattgcaatgggtcccgatttgaggca
aggaaactggtattgtttctgctcttttcttttttgactctttttttttgacttattctttagtatttagtttttagaaa
atcatttagttttcaataaaccttcggtgttagataaaattttgatgttagttccctggttaggcacattattttgaata
tatatatatatatatatataagtatatttatattcgtggaagggggagggaatttctcccatacatttatatataaatac
atttctatattttttattttttatggaaggatgaggagatttctcacatacattactaagttgtcatgatttgcaaataa
atgccctttcactaggctacctaacattttgtacctatgaaattatcaaaattcaaaatcaatctacattcaggtttaat
gaaaaaaataatcttatccagaaattaaaatctaactgtcggtttaacttttttctcaaaatatgtaatattgatcggat
gtctcagtcccctaaactgcaaaacaaactgaagatatcttggccggacgtggaaagtggcaatgatacaagattttggg
aaagcgaatggaacaacacgcactgcc
back to top
>EF653137.1-S-RNase270
tcaccattcatggcctatggccaagtaattattcaaagtacccttgggtggctaattgccctgggacgccatttaacaat
agtttggtatggattgttttgttttgttttctagttactctctagtttttgtattttcctcacaatatatttgttgcttg
gatgtctcagtccccaagaattgaaaccaaactgaagatatcttggcccaacgtggaaaatggcaataatacagaatttt
ggggacgtgaatggaacaaacacggtacat
back to top
>EF653138.1-S-RNase.m1189
tcacaattcatggcctatggccaagtaattattcaaatccaacgaagcccagcaattgcaatgggtcccgatttgaggca
aggaaactgtcccctaaactgcaaaacaaactgaagatatcttggccggacgtggaaagtggcaatgatacaagattttg
ggaaagcgaatggaacaacacgcactgcc
back to top
>EF653137.1-S-RNase.m1186
tcaccattcatggcctatggccaagtaattattcaaagtacccttgggtggctaattgccctgggacgccatttaacaat
agtttgtccccaagaattgaaaccaaactgaagatatcttggcccaacgtggaaaatggcaataatacagaattttgggg
acgtgaatggaacaaacacggtacat
back to top