S-RNase, S-RNase (gene) Prunus mume

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus mume
Synonym S-RNase
self-incompatibility S-RNase
self-incompatibility ribonuclease
S-ribonuclease
Description preventing self-pollination
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseDQ345781.1-S-RNasePrunus mumegene
S-RNaseAM746951.1-S-RNasePrunus mumegene
S-RNaseAB364472.1-S-RNasePrunus mumegene
S-RNaseAB364471.1-S-RNasePrunus mumegene
S-RNaseAB364470.1-S-RNasePrunus mumegene
S-RNaseAB364469.1-S-RNasePrunus mumegene
S-RNaseAB364468.1-S-RNasePrunus mumegene
S-RNaseAB364467.1-S-RNasePrunus mumegene
S-RNaseAB364466.1-S-RNasePrunus mumegene
S-RNaseAB364465.1-S-RNasePrunus mumegene
S-RNaseAB364464.1-S-RNasePrunus mumegene
S-RNaseAB364463.1-S-RNasePrunus mumegene
S-RNaseAB364462.1-S-RNasePrunus mumegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseAF432852.1-S-RNase.m1Prunus mumemRNA
S-RNaseAF432851.1-S-RNase.m1Prunus mumemRNA
S-RNaseAF432850.1-S-RNase.m1Prunus mumemRNA
S-RNaseAF432849.1-S-RNase.m1Prunus mumemRNA
S-RNaseAF432848.1-S-RNase.m1Prunus mumemRNA
S-RNaseAF432847.1-S-RNase.m1Prunus mumemRNA
S-RNaseAF432846.1-S-RNase.m1Prunus mumemRNA
S-RNaseDQ345781.1-S-RNase.m1Prunus mumemRNA
S-RNaseAM746951.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364472.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364471.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364470.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364469.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364468.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364467.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364466.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364465.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364464.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364463.1-S-RNase.m1Prunus mumemRNA
S-RNaseAB364462.1-S-RNase.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ345781.1-S-RNase N/A DQ345781.1
gene parsed from NCBI nr database AM746951.1-S-RNase N/A AM746951.1
gene parsed from NCBI nr database AB364472.1-S-RNase N/A AB364472.1
gene parsed from NCBI nr database AB364471.1-S-RNase N/A AB364471.1
gene parsed from NCBI nr database AB364470.1-S-RNase N/A AB364470.1
gene parsed from NCBI nr database AB364469.1-S-RNase N/A AB364469.1
gene parsed from NCBI nr database AB364468.1-S-RNase N/A AB364468.1
gene parsed from NCBI nr database AB364467.1-S-RNase N/A AB364467.1
gene parsed from NCBI nr database AB364466.1-S-RNase N/A AB364466.1
gene parsed from NCBI nr database AB364465.1-S-RNase N/A AB364465.1
gene parsed from NCBI nr database AB364464.1-S-RNase N/A AB364464.1
gene parsed from NCBI nr database AB364463.1-S-RNase N/A AB364463.1
gene parsed from NCBI nr database AB364462.1-S-RNase N/A AB364462.1
mRNA parsed from NCBI nr database AF432852.1-S-RNase.m1 N/A AF432852.1
mRNA parsed from NCBI nr database AF432851.1-S-RNase.m1 N/A AF432851.1
mRNA parsed from NCBI nr database AF432850.1-S-RNase.m1 N/A AF432850.1
mRNA parsed from NCBI nr database AF432849.1-S-RNase.m1 N/A AF432849.1
mRNA parsed from NCBI nr database AF432848.1-S-RNase.m1 N/A AF432848.1
mRNA parsed from NCBI nr database AF432847.1-S-RNase.m1 N/A AF432847.1
mRNA parsed from NCBI nr database AF432846.1-S-RNase.m1 N/A AF432846.1
mRNA parsed from NCBI nr database DQ345781.1-S-RNase.m1 N/A DQ345781.1
mRNA parsed from NCBI nr database AM746951.1-S-RNase.m1 N/A AM746951.1
mRNA parsed from NCBI nr database AB364472.1-S-RNase.m1 N/A AB364472.1
mRNA parsed from NCBI nr database AB364471.1-S-RNase.m1 N/A AB364471.1
mRNA parsed from NCBI nr database AB364470.1-S-RNase.m1 N/A AB364470.1
mRNA parsed from NCBI nr database AB364469.1-S-RNase.m1 N/A AB364469.1
mRNA parsed from NCBI nr database AB364468.1-S-RNase.m1 N/A AB364468.1
mRNA parsed from NCBI nr database AB364467.1-S-RNase.m1 N/A AB364467.1
mRNA parsed from NCBI nr database AB364466.1-S-RNase.m1 N/A AB364466.1
mRNA parsed from NCBI nr database AB364465.1-S-RNase.m1 N/A AB364465.1
mRNA parsed from NCBI nr database AB364464.1-S-RNase.m1 N/A AB364464.1
mRNA parsed from NCBI nr database AB364463.1-S-RNase.m1 N/A AB364463.1
mRNA parsed from NCBI nr database AB364462.1-S-RNase.m1 N/A AB364462.1

Sequence(s):
>DQ345781.1-S-RNase653
ctatggccaagtaattattcaaacccaaggttgtcccgtaattgcattgggtcgcaatttaagggaatattggtatgtat
tggttttgtttttcacatgctctttagcttttagtttttacaaaatttgattgtcatatggagctaataaaatttttcac
taaaccttgggttttaggtaaaagtttgatgttggtcctttggttcgacacacttgaaaatgtatctaagcacgaaatta
tatatttatattcgtaggtatatattgatttatccatgtatatatttataatattggatttgatgatctaattaagggac
ttaaaatgttgtacttatgtatatatattcaaaaaattgtgctcaatgaaaggatatcaagatcaaaattcaatttaata
ctcaggcttaatgaaaaaaaaatcttatctaaaaatgaaaatgtaaccatccctaaaggttgtacttttttctttggcca
aaaaaagaaaaaaagctttaactttttttctcaaactatgtcttcatttttttttcctcaaatattgcttggatgtctca
gtcccctcaattgcgatccaaactgaagacatcatggccggacgtggaaggtggcaatgatacaaagttttgggaaggcg
aatggaacaaaca
back to top
>AM746951.1-S-RNase1577
tttgtgcaacaatggccaccgaccacctgtagagttcgcaagagaccttgcaccaaaccccggccattacaaatattcac
catccatggcctgtggccaagtaattattcagacccatggaagcccagtaattgcagtgggtcgcaatttaaggacggga
aagtggtatgtattgttttaattttttctttttgtttcacttactcttagaaaattagattatatatgaagatcatatat
tttattcaataaaccttggttgttggataaaattttggtgttggtcatctgctaggcacattattcagaatatcttttga
aatatatagctaactgcaaaattataagtacatttatactcataggtgtaattgatgtacttgtgtataaattatagcca
aaaattcactttcggtatctgtagtttgccaatttttaccactttggtccttataattttaattttgtcaattttatcct
tgtggtttcaattcggagcaatttaaggacatgtttcagtttttgtcaaagtccttgaaatttcacttttatcccgtaat
ttcattgtcaattttatccttgtagttttcaatttagagcaagtcaaggacacattccaatttttgtcaaatccttccca
attctgttaagtttttatcacgcgccagtcacgtgaaagggtggtttgttcctccaatcacccaaaatttaacccaaaga
tgcaatttttttttcttatgaaaccctaatcccaaaaattgtgcttaaagtggatgggaagagctccaccttgtgtttga
ccttcagatggttcaagtgaattgaaatacctttgggcacatggtcaaaacttaacagaattggaggaataagatagaaa
ttgaaatgtgtcattttgaattgaaaactataaggacaaaatcaaatctatggaaccaaagtagtaaaatcaataaatta
atgggaccaaaagtgacgttttgtcaagaatcaaaatggtaatattgtctccacttagttggaggtcttggttcgattca
tatggatgtcgagaactatatatagtgataaattcaatactattcttgatgtaggtgtattggcttattgtaaaagtatt
ttgtaattatcatatcgtttgtcattaaaaaaaacagtcttattaaaaaatgaaactctaactttcccttacgtttttat
tttttctccaaatatgtatatattgcttggatgtttcagtaccctcagttgcgatccaaattgaagaaatcttggcctga
cgtggaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaacatggcacatgttccgaagagaaactaaacc
aaatgcaatacttcgagcgatcccacaacatgtggaggtcgtacaatattacagaggtccttaaaaacgcttcaatcgta
ccacatccgacacaaacatggagctactcagacatagtatcacccattaaaacagcaactggaagaacacccacccttcg
ttgcagaactgatccagcacacccgaatattgagttgttacatgaagtggtattttg
back to top
>AB364472.1-S-RNase555
gttcttgctttcttcttgtgtttcattatgaccactggatcttatgtctattttcaatttgtgcaacaatggccaccgac
cacctgtagagttcgcaagagaccttgcaccaaaccccggccattacaaatattcaccatccatggcctgtggccaagta
attattcagacccatggaagcccagtaattgcagtgggtcgcaatttaaggacgggaaagtgtaccctcagttgcgatcc
aaattgaagaaatcttggcctgacgtggaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaacatggtac
atgttccgaagagaaactaaaccaaatgcaatacttcgagcgatcccacaacatgtggaggtcgtacaatattacagagg
tccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagctactcagacatagtatcacccattaaaacagca
actggaagaacacccacccttcgttgcagaactgatccagcacacccgaatattgagctgttacatgaagtggta
back to top
>AB364471.1-S-RNase555
gttcttgcttttgctttcttcttgtgtttcattatgagcactggatcttatgtctattttcaatttgtgcaacagtggcc
accgaccaactgcagagttcgcatcaagcgaccttgctccaatccccggccattacaatatttcaccatccatggcctat
ggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttgatgcaaggaaagtgtcccctaaa
atgcgaatcaagctgaagaaatcctggccagacgtggaaagtggcaatgatacaagattttggaaagacgaatggaacaa
acatggtacatgttccgaagagagacttaaccaaatgcaatacttcgagcgatcccacgatatgtggttgtcgtacaata
ttactgagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacatactcggacatagtatcacccctt
aaaacagcaactggaagaacacccacccttcgctgcaaacaggataagaagactcagctgttacatgaagtggta
back to top
>AB364470.1-S-RNase561
gttcttggtttcgctttcttcttgtgtttcattatgagcactggatcttatgcctattttcaatttgtgcaacaatggcc
accagccacctgcatacgtagcaacaaaccttgcaccaaacaccggccattaccaatattcaccatccatggcctatggc
caagtaattattcaaacccaaggatgcccagtaattgcagggggtcgctatttgagacaaggaaattgtcccctgaattg
caatccaaactgaagagatcttggcccaacgtggaaaccgacaatgatacaaagctttgggaacacgaatggaacaaaca
tggtacatgttcggaagggacacttaaccaaacgcaatacttccagcgatcccactcaatgtggaggtcgcacaacatta
cggaaatcctcaaaagagctcatatgctaccaaatgcgacacaaacatggaagtactcggacatagaatctcctattaaa
gcagcaactcgaagaacacccttccttcgttgcaagcctgatccacagtctaacaactctcagttgttacatgaagtggt
a
back to top
>AB364469.1-S-RNase561
gttcttgcttttgctttcttcttgtgtttcattatgagcactggatcttatgtctattttcaatttgtgcaacaatggcc
accggccacctgcagatttagccggaaacctgccaacaaacgccggccattacaaattttcaccatccatggcctatggc
caagtaattattcacacccacggaggcccagtaattgcaatgggtcgcaatttaaagacgggaaagtgtaccctcagttg
cgaaccaaactgaagaaatcttggccggacgtagaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaaca
tggtacatgttctgaagagaaactaaaccaaatgcaatacttcgagagatcccacaacatgtggaggtcgtacaatatta
cagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagctactcggacatagtatcacccattaaa
acagcgactggaagaacacccacccttcgttgcagaactgatccagcacacccaaatattgactttttacatgaagtggt
a
back to top
>AB364468.1-S-RNase681
atgacaacgttgaagtcgtcaaccgctctccttgttcttgcatttgctttcttcttttgtttcattatgagcactactgg
atcttatgtctattttcaatttgtgcaacaatggccaccgacgacctgcagatttagcagcaaaccttccaaccaacagc
ggcgattacaaatcttcaccatccatggcctatggccaagtaattattcaaacccaaggatgcctagtaattgcactggg
tcgcaatttaactttacgaaagtgtaccctcaattgcgatccaaactgaagaaatcttggccggacgtggaaagtggcaa
tgatacaagattttgggaaagcgaatggaacaaacatggtacatgttccgaagagaaacttaaccaaatgcagtacttcg
agcgatcccacgagatgtggaactttcacaatattacaaagatccttgaaaacgcttcaatcgtaccaagtgcgacacaa
aagtggagctactcggacatagtatcagccattaaagcaagaactcaaacaacaccctcccttcgttgcaaacgggataa
gaagactcagttgttacacttacatgaagtggtattatgttatgagtataatgcattaaagcagattgactgtaatcgaa
cagcaacatgcggaaatcaacaagccatctggtttcaataa
back to top
>AB364467.1-S-RNase564
gttcttggttttgctttcttcttgtgtttcatgatgagcgctggatcttatgactattttcaatttgtgcaacaatggcc
accgaccaactgcaaagttcgtgggaaaccttgctccaaacctcgcccattacaattcttcaccatccatggcctatggc
caagtaattattcaaacccaacgaggcctagtaattgcattggatctctatttgaggaagggaaattgtaccctcagttg
cgattgaatctgaagagatcttggtccgacgtggaaagtggcaacgatacaaaatattgggcaggtgaatggaacaaaca
tggtagatgttccgaacagacacttaaccaaaggcaatacttcgagcgatcccacgcaatgtggcactttcacaatatta
caaatatcctagaaaacgctcaaatcgtaccaaatgcaacacgaacatggaagtactcggacatagtatcacccattaaa
gcagcaactggaagaacacccctccttcgttgcaaatttgatctatcaaagccaaacaattatcagctgttacatgaagt
ggta
back to top
>AB364466.1-S-RNase558
gttcttggttttgctttcttcttgtgtttcattatgagcactggatcttatgtccatttccaatttgtgcaacaatggcc
accgaccacatgcaaacttagcagcagaccttcctgcaaacaccggccattacaaattttcactatccatggcttatggc
cgagtaattattcaaacccaacgaggcccagtaattgcattgggtcgaaatataacgacagtaaattgtaccctaaattg
cgatccaaactgaagagatcttggcccaacgtggaaactgacaatgatacaaaattttgggaaggcgaatggaacaaaca
tggtacatgttccgaagagacgcttaaccaaatgcagtacttcgagcgatctcacaacatgtggttgtcgcacaatatta
cacatatccttaaaaacgcttcaattgtaccaagtgcgaaacaaaaatggagctactcggatatagtatcagccattaaa
acagcaactaaaagaacacccgtccttcgttgcaaacgtgatccagcaactaatactgagctgttacatgaagtggta
back to top
>AB364465.1-S-RNase561
gttcttgcttttgctttcttgttttgttacgttatgagcagtggatcttatgagtattttcaatttgtgcaacaatggcc
accgaccaactgcagagttcgcatcaaacgaccttgctccaaaccccggccactacaaaatttcaccatccatggccttt
ggccaagtaatttttcaaacccaacgaagcccagtaattgcaatgggtcaaaatatgaggacaggaaagtgtaccctaaa
ttgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatgatacaagattttgggaagacgaatggaacaa
acatggcagatgttccgaacagacacttaaccaaatgcagtacttcgaggtatcccatgacatgtggctgtcgtacaata
ttactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaacatggacctactcggacatagtatcacccatt
aaagcagcaactaaacgaacacccctccttcgttgcaaattagatacagcaactaatactgagctgttacatgaagtggt
a
back to top
>AB364464.1-S-RNase546
ggttttgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaatggccgccgac
caactgcagagctcgcaggagaccttgctctaaaccccggccattacaaaacttcaccatccatggcctatggccaagta
attactcaaacccaacgatgcccagtaattgcaaagggtcacaatttgaggcaaggaaagtgtaccctcaattgcaatcc
aatctgaagatagcttggcccgacgtggaaagtggcaatgatacaaggttttgggaaggcgaatggaacaaacatggtag
atgttccgaacagacacttaacctaatgcaatatttcgagcgatcctatggaatgtggaaatcctataatattacagaga
tccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacttacgcggacatagtatcacccattaaaacagca
actaaaagaacacccctccttcgttgcagacaggataagaatactcagttgttacatgaagtggta
back to top
>AB364463.1-S-RNase543
ggttttgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaatggccaccgac
caactgcagagttcgaactaaatgctccaaaccccggccattacaaatgttcaccatccatggcctatggccaagtaatt
attcaaacccaacgatgcccagtaattgcaatgggtcacaatttgacgcaaggaaagtgtcccctcaattgcgaaacaaa
ctgaagagatcttggcccgacgtggaaagtggcaacgatacaaaattttgggaaggcgaatggaacaaacacggtacatg
ttccgaacagacactcaaccaattccaatacttcgagcgatcccaagacatgtggaggtcgtacaatattacagagatcc
ttaaaaacgcttcaatcgtaccaagtgctacacaaacatggacctactcggatatagtagcacccattaaaacagctact
aaaagaacacccctccttcgttgcaaatacgataagaagactcagttgttacatgaagtggta
back to top
>AB364462.1-S-RNase675
atggcgatgttgaaatcgtcactcgctttccttgttcttgcttttgctttcttcgtgtgtttcattatgagcactggcga
tggatcttatgactattttcaatttgtgcaacaatggccaccaactacctgtagagtacgcgggaaatgctccaatcccc
ggccaatacaaatcttcaccatccatggcctatggccaagtaattattcaaacccaacgacgcccagtaattgcattggg
tcgcaatttaaggaaagcatggtgtcccctcgattgcgatccaaactgaagagatcttggcccaacgtggaaggtagcaa
tgatacaagattttgggaaggtgaatggaacaaacatggtagatgttcccaacagacacttaaccaataccaatacttcg
agcgatcccacgaaatgtggcactttcacaatattacaaatatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggacctactccgacatagtatcaaccattaaagcagtaactcaaacaacaccccttgttcgttgcaaacagcataa
gaagactcagctgttacatgaagtggtattatgttttgagtataaggcattaaagcagattgactgtaatcgaacagctg
gatgcccaaatcaacaagccatctcgtttcaataa
back to top
>AF432852.1-S-RNase.m1264
tttgtgcaacaatggccaccgaccacatgcaaacttagcagcagaccttcctgcaaacaccggccattacaaattttcac
tatccatggcttatggccgagtaattattcaaacccaacgaggcccagtaattgcattgggtcgaaatataacgacagta
aattgtaccctaaattgcgatccaaactgaagagatcttggcccaacgtggaaactgacaatgatacaaaattttgggaa
ggcgaatggaacaaacacggcaga
back to top
>AF432851.1-S-RNase.m1261
tttgtgcaacaatggccaccgactacctgtagagtacgcgggaaatgctccaatccccggccaatacaaatcttcaccat
ccatggcctatggccaagtaattattcaaacccaacgacgcccagtaattgcattgggtcgcaatttaaggaaagcatgg
tgtcccctcgattgcgatccaaactgaagagatcttggcccaacgtggaaggtagcaatgatacaagattttgggaaggt
gaatggaacaagcatggcaca
back to top
>AF432850.1-S-RNase.m1264
tttgtgcaacaatggccaccgaccacctgtagagttcgcaagagaccttgcaccaaaccccggccattacaaatattcac
catccatggcctgtggccaagtaattattcagacccatggaagcccagtaattgcagtgggtcgcaatttaaggacggga
aagtgtaccctcagttgcgatccaaattgaagaaatcttggcctgacgtggaaagtgggaatgatacaaaattttgggaa
ggcgaatggaacaagcacggcaga
back to top
>AF432849.1-S-RNase.m1267
tttgtgcaacaatggccaccgaccaactgcagagttcgcatcaaacgaccttgctccaaaccccggccactacaaaattt
caccatccatggcctttggccaagtaatttttcaaacccaacgaagcccagtaattgcaatgggtcaaaatatgaggaca
ggaaagtgtaccctaaattgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatgatacaagattttgg
gaagacgaatggaacaaacacggcaca
back to top
>AF432848.1-S-RNase.m1264
tttgtgcaacaatggccaccagccacctgcatacgtagcaacaaaccttgcaccaaacaccggccattaccaatattcac
catccatggcctatggccaagtaattattcaaacccaaggatgcccagtaattgcagggggtcgctatttgagacaagga
aattgtcccctgaattgcaatccaaactgaagagatcttggcccaacgtggaaaccgacaatgatacaaagctttgggaa
cacgaatggaacaaacacggcaga
back to top
>AF432847.1-S-RNase.m1261
tttgtgcaacaatggccaccgaccaactgcagagttcgaactaaatgctccaaaccccggccattacaaatgttcaccat
ccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcacaatttgacgcaaggaaag
tgtcccctcaattgcgaaacaaactgaagagatcttggcccgacgtggaaagtggcaacgatacaaaattttgggaaggc
gaatggaacaaacacggcaca
back to top
>AF432846.1-S-RNase.m1255
tttgtgcaacaatggccaccgaccacctgcagatttcgcaagaaatgcttcaaaccccggccattacaaatcttcaccat
ccacggcctatggccaagtaactactcaagcccaacgaagcccagtagttgcactgggtcggaatttaaggaattgcccc
ctcgattgcgacccaaactgaagatatcttggcccaacgtggaaagtagcaatgatacaaaggtttgggaacacgaatgg
gacaaacacggcaca
back to top
>DQ345781.1-S-RNase.m1164
ctatggccaagtaattattcaaacccaaggttgtcccgtaattgcattgggtcgcaatttaagggaatattgtcccctca
attgcgatccaaactgaagacatcatggccggacgtggaaggtggcaatgatacaaagttttgggaaggcgaatggaaca
aaca
back to top
>AM746951.1-S-RNase.m1503
tttgtgcaacaatggccaccgaccacctgtagagttcgcaagagaccttgcaccaaaccccggccattacaaatattcac
catccatggcctgtggccaagtaattattcagacccatggaagcccagtaattgcagtgggtcgcaatttaaggacggga
aagtgtaccctcagttgcgatccaaattgaagaaatcttggcctgacgtggaaagtgggaatgatacaaaattttgggaa
ggcgaatggaacaaacatggcacatgttccgaagagaaactaaaccaaatgcaatacttcgagcgatcccacaacatgtg
gaggtcgtacaatattacagaggtccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagctactcagaca
tagtatcacccattaaaacagcaactggaagaacacccacccttcgttgcagaactgatccagcacacccgaatattgag
ttgttacatgaagtggtattttg
back to top
>AB364472.1-S-RNase.m1555
gttcttgctttcttcttgtgtttcattatgaccactggatcttatgtctattttcaatttgtgcaacaatggccaccgac
cacctgtagagttcgcaagagaccttgcaccaaaccccggccattacaaatattcaccatccatggcctgtggccaagta
attattcagacccatggaagcccagtaattgcagtgggtcgcaatttaaggacgggaaagtgtaccctcagttgcgatcc
aaattgaagaaatcttggcctgacgtggaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaacatggtac
atgttccgaagagaaactaaaccaaatgcaatacttcgagcgatcccacaacatgtggaggtcgtacaatattacagagg
tccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagctactcagacatagtatcacccattaaaacagca
actggaagaacacccacccttcgttgcagaactgatccagcacacccgaatattgagctgttacatgaagtggta
back to top
>AB364471.1-S-RNase.m1555
gttcttgcttttgctttcttcttgtgtttcattatgagcactggatcttatgtctattttcaatttgtgcaacagtggcc
accgaccaactgcagagttcgcatcaagcgaccttgctccaatccccggccattacaatatttcaccatccatggcctat
ggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttgatgcaaggaaagtgtcccctaaa
atgcgaatcaagctgaagaaatcctggccagacgtggaaagtggcaatgatacaagattttggaaagacgaatggaacaa
acatggtacatgttccgaagagagacttaaccaaatgcaatacttcgagcgatcccacgatatgtggttgtcgtacaata
ttactgagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacatactcggacatagtatcacccctt
aaaacagcaactggaagaacacccacccttcgctgcaaacaggataagaagactcagctgttacatgaagtggta
back to top
>AB364470.1-S-RNase.m1561
gttcttggtttcgctttcttcttgtgtttcattatgagcactggatcttatgcctattttcaatttgtgcaacaatggcc
accagccacctgcatacgtagcaacaaaccttgcaccaaacaccggccattaccaatattcaccatccatggcctatggc
caagtaattattcaaacccaaggatgcccagtaattgcagggggtcgctatttgagacaaggaaattgtcccctgaattg
caatccaaactgaagagatcttggcccaacgtggaaaccgacaatgatacaaagctttgggaacacgaatggaacaaaca
tggtacatgttcggaagggacacttaaccaaacgcaatacttccagcgatcccactcaatgtggaggtcgcacaacatta
cggaaatcctcaaaagagctcatatgctaccaaatgcgacacaaacatggaagtactcggacatagaatctcctattaaa
gcagcaactcgaagaacacccttccttcgttgcaagcctgatccacagtctaacaactctcagttgttacatgaagtggt
a
back to top
>AB364469.1-S-RNase.m1561
gttcttgcttttgctttcttcttgtgtttcattatgagcactggatcttatgtctattttcaatttgtgcaacaatggcc
accggccacctgcagatttagccggaaacctgccaacaaacgccggccattacaaattttcaccatccatggcctatggc
caagtaattattcacacccacggaggcccagtaattgcaatgggtcgcaatttaaagacgggaaagtgtaccctcagttg
cgaaccaaactgaagaaatcttggccggacgtagaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaaca
tggtacatgttctgaagagaaactaaaccaaatgcaatacttcgagagatcccacaacatgtggaggtcgtacaatatta
cagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagctactcggacatagtatcacccattaaa
acagcgactggaagaacacccacccttcgttgcagaactgatccagcacacccaaatattgactttttacatgaagtggt
a
back to top
>AB364468.1-S-RNase.m1681
atgacaacgttgaagtcgtcaaccgctctccttgttcttgcatttgctttcttcttttgtttcattatgagcactactgg
atcttatgtctattttcaatttgtgcaacaatggccaccgacgacctgcagatttagcagcaaaccttccaaccaacagc
ggcgattacaaatcttcaccatccatggcctatggccaagtaattattcaaacccaaggatgcctagtaattgcactggg
tcgcaatttaactttacgaaagtgtaccctcaattgcgatccaaactgaagaaatcttggccggacgtggaaagtggcaa
tgatacaagattttgggaaagcgaatggaacaaacatggtacatgttccgaagagaaacttaaccaaatgcagtacttcg
agcgatcccacgagatgtggaactttcacaatattacaaagatccttgaaaacgcttcaatcgtaccaagtgcgacacaa
aagtggagctactcggacatagtatcagccattaaagcaagaactcaaacaacaccctcccttcgttgcaaacgggataa
gaagactcagttgttacacttacatgaagtggtattatgttatgagtataatgcattaaagcagattgactgtaatcgaa
cagcaacatgcggaaatcaacaagccatctggtttcaataa
back to top
>AB364467.1-S-RNase.m1564
gttcttggttttgctttcttcttgtgtttcatgatgagcgctggatcttatgactattttcaatttgtgcaacaatggcc
accgaccaactgcaaagttcgtgggaaaccttgctccaaacctcgcccattacaattcttcaccatccatggcctatggc
caagtaattattcaaacccaacgaggcctagtaattgcattggatctctatttgaggaagggaaattgtaccctcagttg
cgattgaatctgaagagatcttggtccgacgtggaaagtggcaacgatacaaaatattgggcaggtgaatggaacaaaca
tggtagatgttccgaacagacacttaaccaaaggcaatacttcgagcgatcccacgcaatgtggcactttcacaatatta
caaatatcctagaaaacgctcaaatcgtaccaaatgcaacacgaacatggaagtactcggacatagtatcacccattaaa
gcagcaactggaagaacacccctccttcgttgcaaatttgatctatcaaagccaaacaattatcagctgttacatgaagt
ggta
back to top
>AB364466.1-S-RNase.m1558
gttcttggttttgctttcttcttgtgtttcattatgagcactggatcttatgtccatttccaatttgtgcaacaatggcc
accgaccacatgcaaacttagcagcagaccttcctgcaaacaccggccattacaaattttcactatccatggcttatggc
cgagtaattattcaaacccaacgaggcccagtaattgcattgggtcgaaatataacgacagtaaattgtaccctaaattg
cgatccaaactgaagagatcttggcccaacgtggaaactgacaatgatacaaaattttgggaaggcgaatggaacaaaca
tggtacatgttccgaagagacgcttaaccaaatgcagtacttcgagcgatctcacaacatgtggttgtcgcacaatatta
cacatatccttaaaaacgcttcaattgtaccaagtgcgaaacaaaaatggagctactcggatatagtatcagccattaaa
acagcaactaaaagaacacccgtccttcgttgcaaacgtgatccagcaactaatactgagctgttacatgaagtggta
back to top
>AB364465.1-S-RNase.m1561
gttcttgcttttgctttcttgttttgttacgttatgagcagtggatcttatgagtattttcaatttgtgcaacaatggcc
accgaccaactgcagagttcgcatcaaacgaccttgctccaaaccccggccactacaaaatttcaccatccatggccttt
ggccaagtaatttttcaaacccaacgaagcccagtaattgcaatgggtcaaaatatgaggacaggaaagtgtaccctaaa
ttgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatgatacaagattttgggaagacgaatggaacaa
acatggcagatgttccgaacagacacttaaccaaatgcagtacttcgaggtatcccatgacatgtggctgtcgtacaata
ttactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaacatggacctactcggacatagtatcacccatt
aaagcagcaactaaacgaacacccctccttcgttgcaaattagatacagcaactaatactgagctgttacatgaagtggt
a
back to top
>AB364464.1-S-RNase.m1546
ggttttgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaatggccgccgac
caactgcagagctcgcaggagaccttgctctaaaccccggccattacaaaacttcaccatccatggcctatggccaagta
attactcaaacccaacgatgcccagtaattgcaaagggtcacaatttgaggcaaggaaagtgtaccctcaattgcaatcc
aatctgaagatagcttggcccgacgtggaaagtggcaatgatacaaggttttgggaaggcgaatggaacaaacatggtag
atgttccgaacagacacttaacctaatgcaatatttcgagcgatcctatggaatgtggaaatcctataatattacagaga
tccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacttacgcggacatagtatcacccattaaaacagca
actaaaagaacacccctccttcgttgcagacaggataagaatactcagttgttacatgaagtggta
back to top
>AB364463.1-S-RNase.m1543
ggttttgctttcttcttttgttacgttatgagcagtggatcttatgactattttcaatttgtgcaacaatggccaccgac
caactgcagagttcgaactaaatgctccaaaccccggccattacaaatgttcaccatccatggcctatggccaagtaatt
attcaaacccaacgatgcccagtaattgcaatgggtcacaatttgacgcaaggaaagtgtcccctcaattgcgaaacaaa
ctgaagagatcttggcccgacgtggaaagtggcaacgatacaaaattttgggaaggcgaatggaacaaacacggtacatg
ttccgaacagacactcaaccaattccaatacttcgagcgatcccaagacatgtggaggtcgtacaatattacagagatcc
ttaaaaacgcttcaatcgtaccaagtgctacacaaacatggacctactcggatatagtagcacccattaaaacagctact
aaaagaacacccctccttcgttgcaaatacgataagaagactcagttgttacatgaagtggta
back to top
>AB364462.1-S-RNase.m1675
atggcgatgttgaaatcgtcactcgctttccttgttcttgcttttgctttcttcgtgtgtttcattatgagcactggcga
tggatcttatgactattttcaatttgtgcaacaatggccaccaactacctgtagagtacgcgggaaatgctccaatcccc
ggccaatacaaatcttcaccatccatggcctatggccaagtaattattcaaacccaacgacgcccagtaattgcattggg
tcgcaatttaaggaaagcatggtgtcccctcgattgcgatccaaactgaagagatcttggcccaacgtggaaggtagcaa
tgatacaagattttgggaaggtgaatggaacaaacatggtagatgttcccaacagacacttaaccaataccaatacttcg
agcgatcccacgaaatgtggcactttcacaatattacaaatatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggacctactccgacatagtatcaaccattaaagcagtaactcaaacaacaccccttgttcgttgcaaacagcataa
gaagactcagctgttacatgaagtggtattatgttttgagtataaggcattaaagcagattgactgtaatcgaacagctg
gatgcccaaatcaacaagccatctcgtttcaataa
back to top