S-RNase, S-RNase (gene) Prunus salicina

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus salicina
Synonym S-RNase
self-incompatibility ribonuclease
Description preventing self-pollination
Comment RNase; Sc-RNase
RNase; Sb-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseDQ646489.1-S-RNasePrunus salicinagene
S-RNaseDQ646488.1-S-RNasePrunus salicinagene
S-RNaseAM746950.1-S-RNasePrunus salicinagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseDQ646489.1-S-RNase.m2Prunus salicinamRNA
S-RNaseDQ646488.1-S-RNase.m2Prunus salicinamRNA
S-RNaseAM746950.1-S-RNase.m1Prunus salicinamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus salicinagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ646489.1-S-RNase N/A DQ646489.1
gene parsed from NCBI nr database DQ646488.1-S-RNase N/A DQ646488.1
gene parsed from NCBI nr database AM746950.1-S-RNase N/A AM746950.1
mRNA parsed from NCBI nr database DQ646489.1-S-RNase.m2 N/A DQ646489.1
mRNA parsed from NCBI nr database DQ646488.1-S-RNase.m2 N/A DQ646488.1
mRNA parsed from NCBI nr database AM746950.1-S-RNase.m1 N/A AM746950.1

Sequence(s):
>DQ646489.1-S-RNase1921
ctatggccaagtatttattcaaacccaaagattcccagtaattgcaagggggcgctatttgaggcaaggaaagtggtatg
tacgcatttagtttttagaaaaattagattgtcacatgaagacaatatactttgttgataaaccttgggtgttagataaa
tcctgatgttgctcttctgcttgggaacattattttagatatatacacctaagcacacatttatatttgtagctatatta
atgtacctacctgcctacctatacatttataaaagagtactcctattttcatccacccaccttatcttcaaaattttaaa
gagaaatttacccatttgtaaaatgacttctaaaagggcttggggaaaaaagcctcaactcacgtaacccacctattcta
ccgtttgacaaaaagaagaagaagaagaagaaagcgcaatagaaaattaccttcaaatgtataaatttctctttaaaaca
tttatccataatattttcaaaaactacaaggcatataattaaaaaactaaaagatcctgaaaatcaaaatattggactaa
aacatttattgagtccatcaaacacaacttgatcctctccatatctcaattactaatgattagcaaagaaaaatagcttg
aattaataattaaagggtattttaggaataatggtgggtggaaagataagattgtattttttcaaatttacatggtgagt
gggaaaataggacatggggtggaaataacagcactcttataaaaatataagcgatgtcaacggagtctagcatagtgaaa
aatgacattaacttgcaaacaacatgtctcgggttcgaccccgatagcatcttcattttttgtgtgtgtgaaaaatcacc
atctcctgtagtttagactatcttttgtactccaaaaaatgtaaatgatcatctaattaaagcacctatcatatcgtgct
tacgtatatatttaactattgtacatctaaatcaaaattcagtacaatactcaggtttaatatagaaaacaatctaattg
aagaatggatgtatgtgttgcttggatgtctcagtaccctcagttgcaattgaacctgaagatatcttggccggacgtaa
aaagtggcaacgagacaaatttttggcaaagcgaatggaacaagcatggcacatgttctgaacggacactcaaccaaatg
caatacttcgagcgatcagacgaaatgtggaactcgtacaatattacagagatccttaaaaatgcttcaatcgtaccaca
tccgacacaaacatggaagtacgcggacatagaattacccatcaaaacagcaactaaaagaacacccgtcttcgttgcaa
acgtgatccagcacagaataagaccgggccaaagactcagttgttatatgaagtggtattttgttatgattatcatgcaa
aaaggcaaattgactgtaaccgaacagaatgttggaataaagtggacatcaagtttcactaaaatgatacctttctaata
aagtcatggtttagtttggtagtaatgtaataaaaacaaaatgaatgattgcacttacaatttgggaagtcggcctttgc
tgtgtggtaaattattactttttatttctcttttttggtcagttattacttttttttattttgcctgtatcaaaattttt
ttttacaacaagtttgtagttcaaatggtcaattactcatgtctccgagctcctatgtttgaaccaccctccccaatata
acttgtgtaaattaaaaaataaaagagtaaatttcactttactaccctaatctcttttttttttttttttttgggttgaa
gtattggttgaactgtcatataaaaaaagggaaagaataatgacaaaagaaaactaactttatacatttgtttaataatt
a
back to top
>DQ646488.1-S-RNase2407
ctatggccaagtatttattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttaagattttggtatgtattgt
ttcattttgttttgcttagagcatccataatcatgctatctatttttcagttaaatttgaacttttttgtttttgttttt
atcaaatagaaacttcattagataaacgtcaacggtacaatcaaagacatcaacttcattagctaaattttagctaaaaa
catataaaaattattttaggagctctctataaaatttaaactctaataatgctctctactttagggagtcataaatgcta
taactttttttaatcggtccatctctattaaaaagaaatataaaaaataattaacattaattaaaaggtttgaaatactc
attaaataaagtagcattaaattatatggagccattaggagtcatctttctttcctcagatttatgagctcttagaggtc
tccttgttttagaaggtggatagagagcatggttggagttgtattttcccaattcttccctaaaatttgtctaaagaggt
ggattagagagctcattgtagatgttcttactctttagcatttaggtcgaataaagcaaaataagagaatggtaaaacat
tcaaaaatgcaaaaaatacccttaattaatcaaaggactaattaatataatagggataaaatgttaaaacactaatttga
tcaattataaaataaaaaatatataataaattccacctaactaattatatggaggaagttactcccactccactccacat
tcttttttctgttttaatttttaatttttaatttatatatttaacttatgtaaaagagaaatgatatttgcatatggaaa
tttttttaatataaataaataagaaaaaaataacaaggccaagaggctagtatatatttaagtacatttatattcgtaag
tactagcctctctgcacgcgcttccgcgcctgcgagaggtcttttttaaaagaatttaatttttttttagaattaaaaag
ataatgggtaattgtgttccataaaaataggatccattgatatgatttttctmttaattttaattttttttaaagtgtga
atttaccatattatcctcatttaattaataattttaattcttaatgtttgcattaaccaaggacattttatggtattttg
aatgtttcacccattctctgccttttgctttatatatatagatattaatgtatctatgtatctatgtaaactaatgaatt
tgatcatcttattgaaagtcctcattttgtacttgcgtatatattcaaaatattgttcctaatgaaaggatgaaaattca
atttaatactcaggtttaattaaaaaagagtcttaaaatctaaccattttttactttttttctaaaatatgtcgatattg
cttggatgtctcagccccctcaattgatatccaaactgaagatttcttggccggatgtggaaagtggcaatgatacaagg
ttttgggaaggcgaatggaacaaacacggtacatgttccgaacaaacacttaaccaattgcaatacttcgagcggtcata
ctcgatgtggaagtcgtacaatattacagagatacttaaaaacgcttcgatcataccaagtgcgacacaaacatggaagt
actcggacatagtatcagccattaaaacagcaactaaaagaacacccctccttcgttgcaaatgggataagaatactcag
ttgttacatgaagtggtattttgttatggatataatgcaataaagcagattgactgcaatcgaacagcaggatgcaaaaa
taacgttggcatctcgtttcaataaaattatagctttcttagtcacaataaagtagtatggtactactgtaataaaaaca
aaatgaatgattcatttttttatgtcgaacaaaagtacttactgatagatgcttgtaggtttcctacgtttttaagagta
tacacaattttaccagaaacggtcagtgaagaaattagaaaaacatacattatttttttgatgtcctaacgaagctaatt
tattagcaacccaagttagcttcgcgaaagacatgcctgaatgaattgtctaacttggagatcaccaagctatcctttga
tatcctgcatgagagacaaaattccccaaagaggagctttattttcatgcaggaaacgaattaaaatttcaaagtcgctt
ccaattctgggatattattcaaaagggtcatcttgtagttgtgcctggctggatgggctgggatagtcaccaaggaaatg
cttttgattcaaagatcgtccttgcacacacccaaaaaaaaaattccgaaagtaaacagaagccggcaaactttatatac
ctgttta
back to top
>AM746950.1-S-RNase1536
tttcagtttgtgcaacaatggccaccgaccacctgtagagttcgcaagagaccttgcaccaaaccccggccattacaaat
attcaccatccatggcctgtggccaagtaattattcaaacccatggaagcccagtaattgcagtgggtcgcaatttaagg
acgggaaagtggtatgtattgtttcaattttttctttttgtttcacttactcttagaaaattagattgtcatatatatga
agatcatatattttattcaataaaccttgagtgttggataaaagtttggtgttggtcatctgctaggcacattattcaga
atatcttttgaaatatatagctaactgcaaaattataagtacatttatactcayaggtgtaattgatgtacttgtgtata
aattatagccaaaaatttactttcggtatctgtagtttgccaatttttaccactttggtccttataattttaattttgtc
aattttattcttgtggtttcaattcggagcaatttaaggacatgtttcagtttctgtcaaagtccttgaaattccacttt
tatctagtaattccattgtcaattttatccttgtagttttcaatttagagcaagtcaaggacacattccaatttttgtca
aatccttcccaattctgttgagtttttatcacgcaccactcacgtgaaagggtggtttgttcctcccatgtcacccaaat
tttaacccaaagatgcaattttttttcttttgaaaccctaatcccaaaaattgtgcctaaagtggatgggaagagctcca
ccttgtgttttacctttagatggttcgagtggactgaaatacctttgggcacatggtcaaaacttaacagaattggagga
atttgatagaaattgaaatgtgtcgttttgaattgaaaactataaggacaaaatcaaaactatggaaccaatgtagtaaa
atcaataaattatagggaccaaaagtaacgttttgtcaagaatcgaaatggtaatattgtctccatttagttggaggtct
tggttcaattcacatggatggcgagaactatatatatttgtgataaattcaatactattcttgatgtaggtgtattggct
tattgtaagagtattttgtaattatcatatcgtttttattttttctccaaatatgtatatattgcttggatgtttcagta
ccctcagttgcgatccaaattgaagaaatcttggcctgacgtggaaagtgggaatgatacaaaattttgggaaggcgaat
ggaacaaacatggtacatgttccgaagagaaactaaaccaaatgcaatacttcgagcgatcccacaacatgtggaggtcg
tacaatattacagaggtccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagctactcagacatagtatc
acccattaaaacagcaactggaagaacacccacccttcgttgcagaactgatccagcacacccgaatgttgagttgttac
atgaagtggtattttg
back to top
>DQ646489.1-S-RNase.m2519
ctatggccaagtatttattcaaacccaaagattcccagtaattgcaagggggcgctatttgaggcaaggaaagtgtaccc
tcagttgcaattgaacctgaagatatcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaagcgaatgga
acaagcatggcacatgttctgaacggacactcaaccaaatgcaatacttcgagcgatcagacgaaatgtggaactcgtac
aatattacagagatccttaaaaatgcttcaatcgtaccacatccgacacaaacatggaagtacgcggacatagaattacc
catcaaaacagcaactaaaagaacacccgtcttcgttgcaaacgtgatccagcacagaataagaccgggccaaagactca
gttgttatatgaagtggtattttgttatgattatcatgcaaaaaggcaaattgactgtaaccgaacagaatgttggaata
aagtggacatcaagtttcactaaaatgatacctttctaa
back to top
>DQ646488.1-S-RNase.m2480
ctatggccaagtatttattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttaagattttgccccctcaatt
gatatccaaactgaagatttcttggccggatgtggaaagtggcaatgatacaaggttttgggaaggcgaatggaacaaac
acggtacatgttccgaacaaacacttaaccaattgcaatacttcgagcggtcatactcgatgtggaagtcgtacaatatt
acagagatacttaaaaacgcttcgatcataccaagtgcgacacaaacatggaagtactcggacatagtatcagccattaa
aacagcaactaaaagaacacccctccttcgttgcaaatgggataagaatactcagttgttacatgaagtggtattttgtt
atggatataatgcaataaagcagattgactgcaatcgaacagcaggatgcaaaaataacgttggcatctcgtttcaataa
back to top
>AM746950.1-S-RNase.m1509
tttcagtttgtgcaacaatggccaccgaccacctgtagagttcgcaagagaccttgcaccaaaccccggccattacaaat
attcaccatccatggcctgtggccaagtaattattcaaacccatggaagcccagtaattgcagtgggtcgcaatttaagg
acgggaaagtgtaccctcagttgcgatccaaattgaagaaatcttggcctgacgtggaaagtgggaatgatacaaaattt
tgggaaggcgaatggaacaaacatggtacatgttccgaagagaaactaaaccaaatgcaatacttcgagcgatcccacaa
catgtggaggtcgtacaatattacagaggtccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagctact
cagacatagtatcacccattaaaacagcaactggaagaacacccacccttcgttgcagaactgatccagcacacccgaat
gttgagttgttacatgaagtggtattttg
back to top