S-RNase, S-RNase (gene) Prunus speciosa

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus speciosa
Synonym S-locus associated ribonuclease
S-locus-associated ribonuclease
S-RNase
Description NA
Comment putative self-incompatibility protein
putative self-incompatibility gene
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseGU997632.1-S-RNasePrunus speciosagene
S-RNaseGU968646.1-S-RNasePrunus speciosagene
S-RNaseGU968645.1-S-RNasePrunus speciosagene
S-RNaseGU968644.1-S-RNasePrunus speciosagene
S-RNaseAB289902.1-S-RNasePrunus speciosagene
S-RNaseAB289901.1-S-RNasePrunus speciosagene
S-RNaseAB289900.1-S-RNasePrunus speciosagene
S-RNaseAB289899.1-S-RNasePrunus speciosagene
S-RNaseAB289898.1-S-RNasePrunus speciosagene
S-RNaseAB289897.1-S-RNasePrunus speciosagene
S-RNaseAB289896.1-S-RNasePrunus speciosagene
S-RNaseAB289895.1-S-RNasePrunus speciosagene
S-RNaseAB289894.1-S-RNasePrunus speciosagene
S-RNaseAB289893.1-S-RNasePrunus speciosagene
S-RNaseAB289892.1-S-RNasePrunus speciosagene
S-RNaseAB289891.1-S-RNasePrunus speciosagene
S-RNaseAB289890.1-S-RNasePrunus speciosagene
S-RNaseAB289889.1-S-RNasePrunus speciosagene
S-RNaseAB289888.1-S-RNasePrunus speciosagene
S-RNaseAB289887.1-S-RNasePrunus speciosagene
S-RNaseAB289886.1-S-RNasePrunus speciosagene
S-RNaseAB289885.1-S-RNasePrunus speciosagene
S-RNaseAB289884.1-S-RNasePrunus speciosagene
S-RNaseAB289883.1-S-RNasePrunus speciosagene
S-RNaseAB289882.1-S-RNasePrunus speciosagene
S-RNaseAB289881.1-S-RNasePrunus speciosagene
S-RNaseAB289880.1-S-RNasePrunus speciosagene
S-RNaseAB289879.1-S-RNasePrunus speciosagene
S-RNaseAB289878.1-S-RNasePrunus speciosagene
S-RNaseAB289877.1-S-RNasePrunus speciosagene
S-RNaseAB289876.1-S-RNasePrunus speciosagene
S-RNaseAB289875.1-S-RNasePrunus speciosagene
S-RNaseAB289874.1-S-RNasePrunus speciosagene
S-RNaseAB289873.1-S-RNasePrunus speciosagene
S-RNaseAB289872.1-S-RNasePrunus speciosagene
S-RNaseAB289871.1-S-RNasePrunus speciosagene
S-RNaseAB289870.1-S-RNasePrunus speciosagene
S-RNaseAB289869.1-S-RNasePrunus speciosagene
S-RNaseAB289868.1-S-RNasePrunus speciosagene
S-RNaseAB289867.1-S-RNasePrunus speciosagene
S-RNaseAB289866.1-S-RNasePrunus speciosagene
S-RNaseAB289865.1-S-RNasePrunus speciosagene
S-RNaseAB289864.1-S-RNasePrunus speciosagene
S-RNaseAB289863.1-S-RNasePrunus speciosagene
S-RNaseAB289862.1-S-RNasePrunus speciosagene
S-RNaseAB289861.1-S-RNasePrunus speciosagene
S-RNaseAB289860.1-S-RNasePrunus speciosagene
S-RNaseAB289859.1-S-RNasePrunus speciosagene
S-RNaseAB289858.1-S-RNasePrunus speciosagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseGU997632.1-S-RNase.m1Prunus speciosamRNA
S-RNaseGU968646.1-S-RNase.m1Prunus speciosamRNA
S-RNaseGU968645.1-S-RNase.m1Prunus speciosamRNA
S-RNaseGU968644.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289902.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289901.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289900.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289899.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289898.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289897.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289896.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289895.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289894.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289893.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289892.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289891.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289890.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289889.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289888.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289887.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289886.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289885.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289884.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289883.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289882.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289881.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289880.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289879.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289878.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289877.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289876.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289875.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289874.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289873.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289872.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289871.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289870.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289869.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289868.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289867.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289866.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289865.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289864.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289863.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289862.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289861.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289860.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289859.1-S-RNase.m1Prunus speciosamRNA
S-RNaseAB289858.1-S-RNase.m1Prunus speciosamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus speciosagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU997632.1-S-RNase N/A GU997632.1
gene parsed from NCBI nr database GU968646.1-S-RNase N/A GU968646.1
gene parsed from NCBI nr database GU968645.1-S-RNase N/A GU968645.1
gene parsed from NCBI nr database GU968644.1-S-RNase N/A GU968644.1
gene parsed from NCBI nr database AB289902.1-S-RNase N/A AB289902.1
gene parsed from NCBI nr database AB289901.1-S-RNase N/A AB289901.1
gene parsed from NCBI nr database AB289900.1-S-RNase N/A AB289900.1
gene parsed from NCBI nr database AB289899.1-S-RNase N/A AB289899.1
gene parsed from NCBI nr database AB289898.1-S-RNase N/A AB289898.1
gene parsed from NCBI nr database AB289897.1-S-RNase N/A AB289897.1
gene parsed from NCBI nr database AB289896.1-S-RNase N/A AB289896.1
gene parsed from NCBI nr database AB289895.1-S-RNase N/A AB289895.1
gene parsed from NCBI nr database AB289894.1-S-RNase N/A AB289894.1
gene parsed from NCBI nr database AB289893.1-S-RNase N/A AB289893.1
gene parsed from NCBI nr database AB289892.1-S-RNase N/A AB289892.1
gene parsed from NCBI nr database AB289891.1-S-RNase N/A AB289891.1
gene parsed from NCBI nr database AB289890.1-S-RNase N/A AB289890.1
gene parsed from NCBI nr database AB289889.1-S-RNase N/A AB289889.1
gene parsed from NCBI nr database AB289888.1-S-RNase N/A AB289888.1
gene parsed from NCBI nr database AB289887.1-S-RNase N/A AB289887.1
gene parsed from NCBI nr database AB289886.1-S-RNase N/A AB289886.1
gene parsed from NCBI nr database AB289885.1-S-RNase N/A AB289885.1
gene parsed from NCBI nr database AB289884.1-S-RNase N/A AB289884.1
gene parsed from NCBI nr database AB289883.1-S-RNase N/A AB289883.1
gene parsed from NCBI nr database AB289882.1-S-RNase N/A AB289882.1
gene parsed from NCBI nr database AB289881.1-S-RNase N/A AB289881.1
gene parsed from NCBI nr database AB289880.1-S-RNase N/A AB289880.1
gene parsed from NCBI nr database AB289879.1-S-RNase N/A AB289879.1
gene parsed from NCBI nr database AB289878.1-S-RNase N/A AB289878.1
gene parsed from NCBI nr database AB289877.1-S-RNase N/A AB289877.1
gene parsed from NCBI nr database AB289876.1-S-RNase N/A AB289876.1
gene parsed from NCBI nr database AB289875.1-S-RNase N/A AB289875.1
gene parsed from NCBI nr database AB289874.1-S-RNase N/A AB289874.1
gene parsed from NCBI nr database AB289873.1-S-RNase N/A AB289873.1
gene parsed from NCBI nr database AB289872.1-S-RNase N/A AB289872.1
gene parsed from NCBI nr database AB289871.1-S-RNase N/A AB289871.1
gene parsed from NCBI nr database AB289870.1-S-RNase N/A AB289870.1
gene parsed from NCBI nr database AB289869.1-S-RNase N/A AB289869.1
gene parsed from NCBI nr database AB289868.1-S-RNase N/A AB289868.1
gene parsed from NCBI nr database AB289867.1-S-RNase N/A AB289867.1
gene parsed from NCBI nr database AB289866.1-S-RNase N/A AB289866.1
gene parsed from NCBI nr database AB289865.1-S-RNase N/A AB289865.1
gene parsed from NCBI nr database AB289864.1-S-RNase N/A AB289864.1
gene parsed from NCBI nr database AB289863.1-S-RNase N/A AB289863.1
gene parsed from NCBI nr database AB289862.1-S-RNase N/A AB289862.1
gene parsed from NCBI nr database AB289861.1-S-RNase N/A AB289861.1
gene parsed from NCBI nr database AB289860.1-S-RNase N/A AB289860.1
gene parsed from NCBI nr database AB289859.1-S-RNase N/A AB289859.1
gene parsed from NCBI nr database AB289858.1-S-RNase N/A AB289858.1
mRNA parsed from NCBI nr database GU997632.1-S-RNase.m1 N/A GU997632.1
mRNA parsed from NCBI nr database GU968646.1-S-RNase.m1 N/A GU968646.1
mRNA parsed from NCBI nr database GU968645.1-S-RNase.m1 N/A GU968645.1
mRNA parsed from NCBI nr database GU968644.1-S-RNase.m1 N/A GU968644.1
mRNA parsed from NCBI nr database AB289902.1-S-RNase.m1 N/A AB289902.1
mRNA parsed from NCBI nr database AB289901.1-S-RNase.m1 N/A AB289901.1
mRNA parsed from NCBI nr database AB289900.1-S-RNase.m1 N/A AB289900.1
mRNA parsed from NCBI nr database AB289899.1-S-RNase.m1 N/A AB289899.1
mRNA parsed from NCBI nr database AB289898.1-S-RNase.m1 N/A AB289898.1
mRNA parsed from NCBI nr database AB289897.1-S-RNase.m1 N/A AB289897.1
mRNA parsed from NCBI nr database AB289896.1-S-RNase.m1 N/A AB289896.1
mRNA parsed from NCBI nr database AB289895.1-S-RNase.m1 N/A AB289895.1
mRNA parsed from NCBI nr database AB289894.1-S-RNase.m1 N/A AB289894.1
mRNA parsed from NCBI nr database AB289893.1-S-RNase.m1 N/A AB289893.1
mRNA parsed from NCBI nr database AB289892.1-S-RNase.m1 N/A AB289892.1
mRNA parsed from NCBI nr database AB289891.1-S-RNase.m1 N/A AB289891.1
mRNA parsed from NCBI nr database AB289890.1-S-RNase.m1 N/A AB289890.1
mRNA parsed from NCBI nr database AB289889.1-S-RNase.m1 N/A AB289889.1
mRNA parsed from NCBI nr database AB289888.1-S-RNase.m1 N/A AB289888.1
mRNA parsed from NCBI nr database AB289887.1-S-RNase.m1 N/A AB289887.1
mRNA parsed from NCBI nr database AB289886.1-S-RNase.m1 N/A AB289886.1
mRNA parsed from NCBI nr database AB289885.1-S-RNase.m1 N/A AB289885.1
mRNA parsed from NCBI nr database AB289884.1-S-RNase.m1 N/A AB289884.1
mRNA parsed from NCBI nr database AB289883.1-S-RNase.m1 N/A AB289883.1
mRNA parsed from NCBI nr database AB289882.1-S-RNase.m1 N/A AB289882.1
mRNA parsed from NCBI nr database AB289881.1-S-RNase.m1 N/A AB289881.1
mRNA parsed from NCBI nr database AB289880.1-S-RNase.m1 N/A AB289880.1
mRNA parsed from NCBI nr database AB289879.1-S-RNase.m1 N/A AB289879.1
mRNA parsed from NCBI nr database AB289878.1-S-RNase.m1 N/A AB289878.1
mRNA parsed from NCBI nr database AB289877.1-S-RNase.m1 N/A AB289877.1
mRNA parsed from NCBI nr database AB289876.1-S-RNase.m1 N/A AB289876.1
mRNA parsed from NCBI nr database AB289875.1-S-RNase.m1 N/A AB289875.1
mRNA parsed from NCBI nr database AB289874.1-S-RNase.m1 N/A AB289874.1
mRNA parsed from NCBI nr database AB289873.1-S-RNase.m1 N/A AB289873.1
mRNA parsed from NCBI nr database AB289872.1-S-RNase.m1 N/A AB289872.1
mRNA parsed from NCBI nr database AB289871.1-S-RNase.m1 N/A AB289871.1
mRNA parsed from NCBI nr database AB289870.1-S-RNase.m1 N/A AB289870.1
mRNA parsed from NCBI nr database AB289869.1-S-RNase.m1 N/A AB289869.1
mRNA parsed from NCBI nr database AB289868.1-S-RNase.m1 N/A AB289868.1
mRNA parsed from NCBI nr database AB289867.1-S-RNase.m1 N/A AB289867.1
mRNA parsed from NCBI nr database AB289866.1-S-RNase.m1 N/A AB289866.1
mRNA parsed from NCBI nr database AB289865.1-S-RNase.m1 N/A AB289865.1
mRNA parsed from NCBI nr database AB289864.1-S-RNase.m1 N/A AB289864.1
mRNA parsed from NCBI nr database AB289863.1-S-RNase.m1 N/A AB289863.1
mRNA parsed from NCBI nr database AB289862.1-S-RNase.m1 N/A AB289862.1
mRNA parsed from NCBI nr database AB289861.1-S-RNase.m1 N/A AB289861.1
mRNA parsed from NCBI nr database AB289860.1-S-RNase.m1 N/A AB289860.1
mRNA parsed from NCBI nr database AB289859.1-S-RNase.m1 N/A AB289859.1
mRNA parsed from NCBI nr database AB289858.1-S-RNase.m1 N/A AB289858.1

Sequence(s):
>GU997632.1-S-RNase942
atggcgatgttgaagtcgtcacccgctttccttgttcttgctttggtcttgttctggtgtttcagtacgagcactggtgg
gttgcattagaaatatttgtgctctatggtatatgtactttgttatttattacagttaccattgcgtttctatacttgta
ttttcactcggatcaagtaattattgtttgggaattattttctacattgttacttttgtgtttcagtaagctaaaattat
gttctttatgcaggatcttatcaatattttcagtttgtgcaacaatggccgccaaccacctgcgcaattagcaaaaaacc
ttgctaccaaaacccgccctcaatcttcaccatccatggcctatggccaagtaattattcaaaaaacgcttgggtggcta
attgcagtccaacgcgatttaacaatagtttggtatggactgttttgtttttctagttagtctttagtttttgtatgttc
gtcacaatatattttattgcttgcatgtctcagtctcctaggttggaaaccaaactgaagatatcttggcccgacgtgga
aagtggcaattatacagacttttgggaacgtgaatggaacaaacatggcacatgttccgaacaaacacttgaccaagaac
aatacttcgagcgatcccacgatatttggaacgcatacaatataacaaatatccttaaaagggctaaaatcctaccaact
ggggggaaatgggactactcggacatagtatcacccattaaaacagcaattcgcaaaatgccagcccttcgttgcaaacc
tgatccaacactccctaaaaaccataacatctctcatcaactgctacatgaagtggtgctttgtttgcattataatggaa
gagctctgattgactgtaacaacccatcatgcaaaaataaccttaagatcttgttccaataa
back to top
>GU968646.1-S-RNase1780
atggcggtgttgaaatcgtcacccgctttccttgttcttgcttttgctttcttcttgtgtttaattatgagcactggtga
tggtgggttgaattacaatcttttgctctttataatcctatatgcatataattagcactgtatttttctacttctagcgc
acaactttatttggatgagtaactatttgggaatgtctttctgcatggtttctttcatttacagatagttgttgcaataa
gagcactcatcattggaaagctaaaactatcttctttatacatcgaatccttattaagataccattaacattctcaaaat
aaatttggcaggatcttacgcctattttcaatttgtgcaacaatggccaccgaccacttgcagaattagcaataaatctt
gccaccaacagcgaccgttacaaatgttcaccatccatggcctatggccaagtaattattcaaacccaaggaagcccagt
agttgtaccgggtcgcaatttaagttagagaaattggtatgtattgttttattttactctttagcatttagattttatta
aattaggttgccatcatatgaagatgatatacttctatcgataaagtttgggtgttggagaaaaatttagacgttggtct
tctcgttaggcacattattttgaatgtatgctaagttgtaaggaagtttatatttataggtatgtcaactggtccctcct
ccaccactaacgtcccctccctttcagaatacgatcatgaaaggattttttttcttttcttgtttatgtttttctcaaat
ctttttgtgaaactataaagtgggcccggactatattaggggttttcggtggagtaagaatttaggcatttcgaaaagga
tctgggtggttttctgcaaggtgggatttgaaaaatttttgagaagttgatttggtgaatttggagggttagaatgttct
atgattgctacctctcctcagatgatgagtagaaaatccttaatcatctactattacgacctgtccttggatcttagctg
cattctatcgcctctccttttccgtttacttctaagggttgaaacttttgtcattttttcaaaatgttattccttatgct
tttgagttcttatatttcaaatgaaattaatgagtttttttttaaagtaatgctttgcagttttagtgattagggactct
cattttttaatacttagttttaatgaaaaaaaatcttattcaaataactgttgttcatgaagttttgaattcttcttttt
ttaatcgaaatatatgtctataatgtattgctcgcatgtctcagtacccaaaattgcgatccaaactgaagatatcttgg
cccaacgtcgaaagcgggaatgataccaagttttgggaatccgaatggaacaaacacggtacgtgttccgaacagacact
taaccaattccaatacttccagcgatcccacggaatctggaacgcgtacaatatgacaaatatccttaaaagggctcaaa
tcataccaagtgcgacaaatacgtggaagtactcggacattgtatcacccattaaagcagtaactaaaactacaccctta
cttcgttgcaaacatgatccaaaaccgcttcagagccatccagcacagtctaagagccggccgaagcctcagttgttaca
tgaagtggtactttgttttgattatgatgcgttaaagcagattgactgtaatcgaacagcaggatgcctgaatcaagttg
acatcttgtttcctcaataa
back to top
>GU968645.1-S-RNase1933
atggcggtgttgaaatcgtcactcgctttcattgttcttgcttttgctttcttcttgtgtttcattatgagcgctggtga
tggtgagttgcgttataaccagcattgcgtttttctacttgtattttttgttcagagaaactaatgtgtgttcgatgata
catcacatgacatgcggtgtattgaattcacacccacatatttttcatttaatctaacacacaactttcttaggatgagt
aagtatttggggatattttctgctgcatgtcctctttttattttcattctcctttgtttattctgataattgttgcaata
agtgcagtctattcatcacaataattttggcaggatcttatgactattttcaatttgtgcaacaatggccaccgaccaac
tgcaaagttcgcgggaaaccttgctccaaaccccggccattacaaatcttcaccatccatggcctatggccaagtaatta
ttcaaacccaacgaggcctagtaattgcattggatcgctatttgaggaagggaaattggtatgtattgtttctttatatt
ttttttctttttcagttactctttatatttagttctaagaaaattagattgtcatttgaagctaatataattattagaaa
atttcatttgataaacttcaacagttcaatccaatacatcaacataacatctaaagcaccaatcccaagagggaaacaaa
ctaacatgttaaaaacaaaactaaagagcttgtatacaaaaaaaaaaaaaacctaaacagacaaaaacagcactacaatt
accatcccacatcaccataattaacaataaacccaaacaaagtctacaaaacaaacataaccgaaaccataaagcaacac
aggagcctaaatgaaccctaccaccaccacctaaaaaagctacgtcgctgccacacccactactgcattcgtaacagata
tgaggaaaatataatttccagcgatctataacaatgacttttaatttgtttcaattatttactttcaatagcaaaatagc
cataaaaataagtaataaatacaaaatgggtctcgattcaataagtgcataaggattttttttcaacatttttagcatgg
aacaggtctatattaaaagacccctatgattatttcgatatgccttgggtatcagataaagttttggctttaattaggca
gattattttgaatatatacctaagaacaaaatgataacaacatttgcatatataggttaggtcagttgaccaggttagtg
tgcttgccctttgtatgtgagtttgaatcccctttccaaaattcagagcattatcaaaagagagtttataagtaaattta
tatatgtgattctgtaggtatattaatgtagttacatttacattcacaataatgtatacggtcatctacttaaaagaacc
taccattttgtacttatgtataactatcccctgaagtttttacttttttctcacaacttggatgcctcagtaccctcagt
tgcgattgaatctgaagagatcttggcccgacgtggaaagtggcaatgatacaaaattttggtcaggtgaatggaacaaa
catggtagatgttcggaacagacacttaaccaaaggcaatacttcgagcgatcccacgcgatgtggaactcatacaatat
tacaaatatcctagaaaacgctcaaatcgtaccaaatgcaacacaaacatggaagtactcggacatagtatcacccatta
aaacagcaactggaagaacacccctccttcgttgcaaatctgatccaaaaaagtcaaacaattatcagttcttacatgaa
gtggtattttgttatgggtatagagcaaaaaagcagattgactgtaatcgaacagcaggatgctggaataatgttgacat
caagtttgagtaa
back to top
>GU968644.1-S-RNase1086
atggggatgctgaaatcgtcactcgctttccttgttcttgttcttactttcttcttgtgtttcattatgagcgctggtga
tggtgggttgcgtactatatatcctatatgcataagatcagcgttgcgtttttcatttaatctaaagcaaaactttcttt
ggataagtattggggattgattttttgcatgtcctctttttattttcatcctcatttttttattctgataattgttgcaa
taagtgcggcctattgattacaataattttggcaggatcttacgactattttcaatttgtgcaacaatggccaccgacca
actgcagagttcgcatcaagcgaccttgctccaacccccggccattacaatatttcaccatccatggcctatggccaagt
aattattcaaacccaacgatgcccaataaatgcactgggtcgaaatttaactttacgaaagtggtatgtattgttttctt
ttttcacttactctttagcatttaattcttagaaaattagactgtcatttgatgatagaatagaccttggattttagata
aaattgtgatgttggtcctctgcgagttttgattttgatcctcacatttcacttactcttacctttttactgtttctcaa
aatatgtatgtatttcttggatgtctcagttcccttatttgcgatccaacctgaagaaatcttggccggacgtggaaagt
ggaaatgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttcctcacggatacttaaccaaatgcaata
cttccaacggtcccacgcaatgtggaaatcacacaatattacagagatcctaaaaaacgcttcaatcgtaccaagtgcga
cacaaacatggacctactccgacatagtagcacccattaaaacagcaaccaagagaacacccgtccttcgttgcaaaagt
gatccagcaactaataccgagttgttacatgaagtggtattttgttatgaatataatgcattaaagctgattgactgtaa
tcgaacagcaggatgcaaaaatcaacaacgcatctcgtttcaatag
back to top
>AB289902.1-S-RNase506
tattttcaatttgtgcaacaatggccatcgaccaactgcagagttcgcatcaagctaccttgctcccacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattactcaaacccaacgaagcccagtaattgcgctgggtcgcaat
ttagctttactaaagtgtaccctcaattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaatgataca
aagttttgggaaggcgaatggaacaagcatggtacatgttccgaccagacacttaatcaaatggattactttgagacatc
ccacgacatgtggatgtcgtacaatatcacggagatccttaaaaacgcttcaatcgtaccaagtgcgacgaaaacatgga
agtactcggacatagtatcacccattaaaagagcaactggaagaacacccacccttcgctgcaaatacgataagaagatt
cagttgttacatgaagtggtattttg
back to top
>AB289901.1-S-RNase506
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaacccccggccatt
acagtatttcaccatccatggcctatggccaagtaattattcaaacccaacgaggcctagtaattgcaatgggtcgaaat
ttaactttacgaaagtgtaccctcaattgcgaaaagatctgaagaaatcttggccggacgtggaaagtggcaatgataca
aaattttgggaaggcgaatggaacaaacatggtacatgttccgaagagtcacttaaccaaatgcaatacttcgagcgatc
ccacgaaatgtggagctcgtacaatattacggagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
agtactcggacatagtagcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacaggacaagaagact
gagttgttacatgaagtggtattttg
back to top
>AB289900.1-S-RNase527
tattttcaatttgtgcaacaatggtcaccgatcaactgcagagttcgcatcaagaaaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaggtaattattcaaacccaacgatgcccagtaattgtaatgggtcgcaat
ttgaggacaggaaagtgtaccctcaactgcggaccaaactgaagaaatcttggcccgacgtggaagatggcaatgataca
aagttttgggaagccgaatggaacaagcatggtacatgttccgaacagacgcttaaccaaatgcaatacttcgaggtatc
ccaggacatgtggagatcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatgga
agtactcggacatagaatcacccattaaaacagcaactaaaagaacacccatccttcgttgcaaacgtgatccagcatgg
aataagaccgggccgaggactcagttattacatgaagtggtattttg
back to top
>AB289899.1-S-RNase503
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcaataaaccttgtaccaaaccccggccattaca
aaacttcaccatccatggcctatggccaagtaattattcaaacccaaggatgcccagtaagtgcactgggtcgctattta
actttaggaaagtgtaccctcaattgcgttccgatctgaagatatcttggccagacgtggaaagtggcaatgatacaagg
ttttgggaaagcgaatggagcaaacatggtagatgttccgaagactcacttaaccaaatgcaatacttcgagcggtcgca
cgcaatgtggatatcgtacaatatcacagagatccttaaaaacgcttcaatcgtaccgagtgcgacaaaaaactggacct
actcggacatagtatcacccattaaaagagcaactaaaagaacacccctcctccgttgcaaatacgataagagcactcag
ttgttacatgaagtggtattttg
back to top
>AB289898.1-S-RNase548
tattttcaatttgtgcaacaatggccaccggccacttgcatacgtagcacgagaccttgctccaaacaccggccattaca
aattttcaccatccatggcctatggccaagtaattactcaaagcccacgatgcccggtaattgcgttgggtcggaattta
agatggataacttgtctcctaaattgcgatccaaactgaagatatcttggcccgacgtggaaaggagcaatgatacagag
ttttgggaaggagaatggactaaacatggaacttgttccgaacaggcacttaaccaattccaatacttccagcgatcaga
ctcaatgtggagatcgcacaacattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagct
actccgacatcgtatcacccattaaaaaagcaactaaaagaacacccctccttcgttgcaaacctgatccagcactgcct
aagaagagccaacgagcacaacctaatagcccgccacagtctcagttgttacatgaagtggtattttg
back to top
>AB289897.1-S-RNase506
tattttcaatttgtgcaacagtggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaatccccggccatt
acaatatttcaccatccatggcctatggcctagtaattattcaagcccaacgaagcccagtaattgcaatgggtcgcaat
ttgatacaaggaaagtgtcccctaaaatgcgaatcaagctgaagaaatcttggccagacgtggaaagtggcaatgataca
agattttggaaagacgaatggaacaaacatggtacatgttccgaagagagacttaaccaaatgcaatacttcgagcgatc
ccacgatatgtggttgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
catactcggacatagtatcacccattaaaacagcaactggaagaacacccacccttcgctgcaaacaggataagaagact
cagttgttacatgaagtggtattttg
back to top
>AB289896.1-S-RNase542
tattttcaatttgtgcaacaatggccaccgaccaactgcataattcgcacgaaatgctccaaaccccggccattacaaat
gttcaccatccatggcctatggccgagtaattattcaaacccaacgatgcccagtaattgcaatggagcgcattttgaga
acaggaaagtgtaccctcaattgcgatccaaactgaagaggtcttggccagacgtggaaagtggcaacgatacaaacttc
tgggaaagagaatggaacaaacatggtaaatgttccgaacagacactgaaccaaatgcaatacttcgagcgatcccacga
aatgtggaaatttcacaatattacggagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacctact
ccgacatagtatcagccattaaagcagtaacccaaacaacaccctaccttcgttgcaaaccacatccaacaaagcctaag
agccatccatcacagcgtaagagccaaccgaaacttcagttgttacatgaagtggtattttg
back to top
>AB289895.1-S-RNase521
tattttcaatttgtgcaacaatggccaccgaccaactgcaaaattcgcaagaaatgctccaaacccctgccattgcaaat
gttcaccatccatggcctatggccaagtaatcattcaaacccaacgacgcccagtaattgcagtggggcgcaatctgatg
acaggaaagtgtacccccgattgcgatccaaactgaagatatcttggccggacgtggaaaatggcaatgatacaaaattt
tgggaaggagaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagcgatcctacga
aatatggaacttgttcaatattacgaatatccttaaaaatgcttcaatcgtaccaagtgcgacacaaacatggacctact
ccgacatagtatcaaatattaaagcagtaactcaaagaacacccctccttcgttgcagacgcaatccagcatataataag
agcgggccgagctctcagttgttacatgaagtggtattttg
back to top
>AB289894.1-S-RNase548
tattttcaatttgtgcaacaatggccaccgaccacctgcagagttaggaataaaccttgctccaaactccggccgttaca
aattttcagcatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcaatttg
agggagggaaagtgtcccctcgattgcaatccaagctgaagatatcttggcccaacgtggaaagtaccaatgatacaaaa
ttttgggaaggcgaatggaacaaacgtggtacatgttccgaacagacacttaaccaaatacaatacttcgagcgatcaca
cgacatgtggatgtcgcataatatgacaaagatatttcaaaacgcttcaatcgtaccgcatccgacacaaacatggaaat
acagggacatagtatcatccattaaagcagtaactcaaacaacaccctcccttcgttgcaaacctgattcagcacagcct
aagagccataagagccatccagcacagcctaagagtcggtctcagttgttacatgaagtggtattttg
back to top
>AB289893.1-S-RNase506
tattttcaatttgtgcaacaatggccaccgatcacctgcagatttagccggaaaccttcctacaatcaccggccattaca
aaatttcaccatccatggcctctggccaagtaactattcaaacccatggaggcccagtaattgcactgggacgcaattta
aacaattgtcccctcaattgcgatccaaactaaagatatcttggcccgacgtggaaggtggcaatgatacaaggttttgg
gaaatggaatggaacaaacatggtacatgttccgaagagtcacttaaccaaatgcaatacttccagcgatccttcgcaat
gtggagatcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatggaagtactcgg
acatagtatcacccattcaaacagcaattaaaagaacacccctccttcgttgcaaacgtgacaaagcacacccgaatatt
cagtggttacatgaagtggtattttg
back to top
>AB289892.1-S-RNase509
tattttcaatttgtgcaacaatggccaccgacgacctgcagatttagcagcaaaccttccaaccaacagcggcgattaca
aatcttcaccatccatggcctatggccaagtaattattcaaacccaaggatgcctagtaattgcactgggtcgcaattta
actttacgaaagtgtaccctcaattgcgatccaaactgaagaaatcttggccggacgtggaaagtggcaatgatacaaga
ttttgggaaagcgaatggaacaaacatggtacatgctccgaagagaaacttaaccaaatgcagtacttcgagcgatccca
cgaaatgtggaactttcacaatattacaaagatccttgaaaacgcttcaatcgtaccaagtgcgacacaaaagtggagct
actcggacatagtatcagccattaaagcaagaactcaaacaacaccctcccttcgttgcaaacgggataagaagactcag
ttgttacacttacatgaagtggtattttg
back to top
>AB289891.1-S-RNase506
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcaaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgtaatgggtcaaaat
ttgacgcaaggaaagtgtcccctcaattacgaaacaaactgaagatatcttggccggacgtggaaagtggcaatgataca
aaattttgggaaggcgaatggaacaaacatggtacatgttccgagcagacacttcaccaaatgcaatacttcgagctatc
ccacgacatgtggctgtcccacaatattacagaaatccttaaaaacgcttcaatcttaccacatccgacacaaacatgga
cgtactcggacatattatcacccattaaagcagcaactaaaagaacaccccttcttcgttgcaaacgggataagaacact
cagttgttacatgaagtggtattttg
back to top
>AB289890.1-S-RNase542
tattttcaatttgtgcaacaatggccaccgaccacctgcagactgagcacgaaacctagcaacaaacatcggccattaca
aaatttcaccatccatggcctatggccaagtaattattcaaacccaaagatgcccagtaattgcgctgggtcgcaattta
agaaaatattgtcccctaaactgctaaccaaactgaagagatcttggcccgacgtggaaaaaggcaatgatacagaattt
tgggaaagcgaatggaacaaacatggtacttgttccgaacagacatttaaccaaatgcagtacttcaagcgatcccacga
aatgtggagctcgtacaatattacacacatccttaaaaatgcttcaatcgtaccaagtgcgacacaaacatggacctact
cggacatagtatcagccattaaaacagtaactcaaacaacacctctccttcgttgcaaaccttatccagcacagcctaaa
agccatccagcacagcgtaagagcctgccgaagcctcagttgttacatgaagtggtattttg
back to top
>AB289889.1-S-RNase512
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcggatcaagcgaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgcggcccagtaattgcaatgggtcacaat
ttgacgcaaggaaagtgtacccccgattgagatccagactgaatagatcttggccggacgtggaaagtggcaatgataca
aaattttgggaaagcgaatggaataaacatggcacatgttcccaacggatacttaaccaatacctatacttcgagcgatc
ccacgaaatgtggagatcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgcgacacaaacatgga
cctactcggacatagtagcacccattaaagcagcaactaaaagaactcccctcctccgttgcaaaactgatctagcaact
aatactgagttgttacatgaagtggtattttg
back to top
>AB289888.1-S-RNase524
tattttcaatttgtgcaacaatggccaccggccacctgcatacgtagcacgaaaccttgctccaaacaccggccattaca
aattttcaccatccatggcctatggccaagcaattattcaaacccaaagatgcccagtaattgcgtcgggtcgcaattta
acgaaagtaaattgtaccctcaattgcgatccagactgaagaggtcttggccagacgtggaaagtggcaatgatacaaag
ttttgggaaggcgaatggaacaaacatggtacgtgttccgaacagatacttgaccaaatccaatacttcgagcgatctca
cgaaatgtggaactcgttcaatattacgcatatccttaaaaacgcttcaatcgtaccaagcgctacacaaacatggaagt
actcggacatagtatcagccataaaagcagtaactaaaagaacccccgcccttcgttgcaaaagcaatccaactcagcct
aagggccaagcgaagactcagttgttacatgaagtggtattttg
back to top
>AB289887.1-S-RNase530
tattttcaatttgtgcaacaatggccaccaaccacctgcgctgttaggaaaacaccttgctatcaaaacccgccatcaaa
aatcttcaccattcatgggctttggccaagtaattattcgaaaaacgcttgggtggctaattgcaatgggacccgattta
gcaatagtttgtctcctgcactggagtccaaactgaagaaatcttggcccgacgtggaaagtggcaacgatacagacttt
tggggacgtgaatggaacaaacacggtacatgttccgaacaaacacttgaccaggaactatacttccaacggtcccacat
tatttggaaagcattcaatatcacaaatatacttcaaaacgctaaaatcctaccaaatgggtcaaaatgggactacgcag
acatagcatcacccattaaagcagttactaccaaaatgcccactctccgttgcaaacctgatccaacacagcctaaaaac
cctaacaacctgacgatgtctcatcagctgttacatgaagtggtattttg
back to top
>AB289886.1-S-RNase530
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgaacgaaatgctccaacccccggccattacaaat
cttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcattgggtcgcaatttaacg
aaagtaaactgtaccctcatttgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaacgatacagacttc
tggggaaaagaatggaacaaacatggtaaatgttccgaacagacacttaacctaatgcaatacttccagagatcccacga
aatgtggaattcgttcaatattacagatatccttaaaaaagcttcaatcgtaccaagtccgaaccaaacatggacctata
cggacatagtatcagcccttaaaacaagaaccaaaagaactcccctccttcgttgcaaacctgatccaaaggcgaagtct
cagcctacaagccagcccaagcctgagttgttacatgaagtggtattttg
back to top
>AB289885.1-S-RNase515
tattttcaatttgtgcaacaatggccaccgaccagctgcaaagttcgcgggaaaccttgctccaaaccccggccattaca
aatcttcaccatccatggcctatggccaagtaattattcaaacccaacgaggcctagtaattgcattggatcgctatttg
aggaagggaaattgtaccctcagttgcgattgaatctgaagagatcttggcccgacgtggaaagtggcaatgatacaaaa
ttttggtcaggtgaatggaacaaacatggtagatgttcggaacagacacttaaccaaaggcaatacttcgagcgatccca
cgcgatgtggaactcatacaatattacaaatatcctagaaaacgctcaaatcgtaccaaatgcgacacaaacatggaagt
actcggacatagtatcacccattaaaacagcaactggaagaacacccctccttcgttgcaaatctgatccaaaaaagtca
aacaattatcagttcttacatgaagtggtattttg
back to top
>AB289884.1-S-RNase518
tattttcaatttgtgcaacaatggccaccaaccacctgcgcacttagcaaaaatccttgctaccaaaacccgccctcaat
cttcaccatccatggcctatggccaagtaattattcaaaaaacgcttgggttgctaattgcagtccaaagcgatttagca
atagtttggctcctaaattggaggccaaactgaagatatcttggccgaacgtggaaaatggcaatgatacagagttttgg
gaacgtgaatggaacaagcatggcacatgttccgaacaaacactagaccaagaactgtacttccagcgatcccaccatat
ttggaacgcatacaatatcacaggtatccttaaaaatgctaaaatcctaccaaatggggcaaaatgggactactcagaca
tagtatcacccatcaaaacagcaactcgcaaaatgcccgcccttcgttgcaaacctgatccaacactgcctaaaaacaat
accatgtctcatcagctgttacatgaagtggtattttg
back to top
>AB289883.1-S-RNase527
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaatccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcattgggtcgcaat
ttaactttacgaaagtgtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaatgataca
aggttttgggaaggcgaatggaacaaacatggtacatgttcggaagattcacttaaccaaatgcaatacttcgagcgatc
ccacgaaatgtggtattcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
agtactcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatccagcacag
aataagagtgggccgaagactcagttgttacatgaagtggtattttg
back to top
>AB289882.1-S-RNase524
tattttcaatttgtgcaacaatggccaccggctacctgcagacttagcaggacaccttgctacaaaccccggccacctca
aatcttcaccatccatggcctatggccaagtaactattcaaacccaaagaggcccagtaattgcagggggtcgctatttg
atttaaggaaagtgtaccctcagttgcgattgaatctgaagatatcttggcccaacgtgaaaagtggcaatgatacagaa
ttttgggaaagcgaatggaacaaacatggtagatgttccgaacagacactcaaccaaatgcaatacttcgagcgatcaga
cgaaatgtggaactcttacaatattacggagatccttaaaaaagctcaaatcgtaccaaatgcgacacggacatggaagt
acacggacatattatcacccattaaagcagcaactaacacaacacccatccttcgttgcaaacctgatccatcgcagcct
aagagcccccaaaagcctcagttgttacatgaagtggtattttg
back to top
>AB289881.1-S-RNase503
tattttcaatttgtgcaacaatggccaccgactaactgcagagttcgcaataaaccttgctccaaaccccggccattaca
aatcttcaccatccatggcctatggccaagtaattattcaaacccaaggaggcctagtaattgcgctgggtcgccattta
actttacgaaagtgtaccctcatatgcgatccaaactgaagatatcttggcctgacgtggaaagtggcaatgatacaaaa
ttttgggaaggcgaatggaacaaacatggtacatgttctgaagagagacttaaccaaatgcaatacttcgagcgatccca
cgacatgtggatgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagt
actcggacatagtatcacccattaaaaaagcaactggaagaacacccctccttcgttgcaaatacgataagagcactcag
ttgttacatgaagtggtattttg
back to top
>AB289880.1-S-RNase521
tattttcaatttgtgcaacaatggccaccgactaactgcatagtgcatacgaaatgctccaatccccggccattacaaat
gttcaccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgcaatgggtcaaaatttgatg
caaggaaagtgtaccctcaattgcaatccaaactgaagaagtcttggcctgacgtggaaagtggcaatgatacgaaattt
tgggaaggcgaatggaataaacatggtacatgctccgaacagacactcaaccaataccaatacttcgagatatcccacga
catgtggtattcgttcaatattacaaacatccttaaaaacgcgtcaatcctaccaagtacgacacaaacatggacctact
ccgacatagtagcacccattaaaacagtaactaaaagaacacccctccttcgttgcaaacgcgatccagcacggaataag
agcctgccgaactatcagttgttacatgaagtggtattttg
back to top
>AB289879.1-S-RNase500
tattttcaatttgtgcaacaatggccgccgaccaactgcaaaattagcacgaaatgctccaaaccccgggcattacaaat
gttcaccatccatggcctatggccaagtaattattcaaacccaacgctgcccagtaattgccaagggtcgctttttgagg
caaggaaagtgtaccctcaattgcaaaccaaactaaagagatcttggcccgacgtggaaagaggcaatgatacaaaattt
tgggaaggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagctttcccacca
aatgtggatgtcgcataatattacagatatcctttatagggctcaaatcgtaccaaatgcgacaaaaacatggaactact
gggacatagtgtcacccattaaagcggcaactaatacaacaccactccttcgttgcaaagtggttaagaagactcagttg
ttacatgaagtggtattttg
back to top
>AB289878.1-S-RNase539
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcaaatgctccaaaccccggctattacaaaactt
caccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgcatgggatcgcaatttaacgaaa
ggaatttgtcccctaaattgctaaacaaactgaagagatcttggcccgacgtggaaagtggcaatgatacaaacttttgg
gaacgcgaatggaacaaacatggtagatgttccgaacgtacatttaaccaaatgcaatacttcaagcgatcccacgaaat
gtggagctcgtacaatattacaggtatccttaaaaatgcttcaatcgtaccacatgcgacacagacatggacttactcgg
acatagtatcaaccattaaagcagcaactataacaacacctttgcttcgttgtaaacctgatcgagcacagcctaagagc
catccagcacagcctaagagcgggccgaagcctcagttgttacatgaagtggtattttg
back to top
>AB289877.1-S-RNase524
tattttcaatttgtgcaacaatggccaccggccacttgcatacgtagcacaaaaccttgctccaaacaccggtcattacc
aattttcaccatccatggcctatggccaagtaattattcaaacccaaagacgcctagtaattgcaatgggtcgcaatttg
acgcaattaaattgtcccctcgattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaatgatgaaggg
ttttgggaaggcgaatggaacaaacatggtaaatgttccgaacagacacttaaccaaatgcaatacttcgagcgatccca
cgaaatgtggatttttcacaatattacgaagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatggaagt
acacggacatagtatcagccattaaagcactaactcaaacaacacccctccttcgttgcaaacgtgatccagcacaggtt
aagggccagccgcagtctcagttgttacatgaagtggtattttg
back to top
>AB289876.1-S-RNase518
tattttcaatttgtgcaacaatggccgccaaccacctgcgcaattagcaaaaaaccttgctaccaaaacccgccctcaat
cttcaccatccatggcctatggccaagtaattattcaaaaaacgcttgggtggctaattgcagtccaacgcgatttaaca
atagtttgtctcctaggttggaaaccaaactgaagatatcttggcccgacgtggaaagtggcaattatacagacttttgg
gaacgtgaatggaacaaacatggcacatgttccgaacaaacacttgaccaagaacaatacttcgagcgatcccacgatat
ttggaacgcatacaatataacaaatatccttaaaagggctaaaatcctaccaactggggggaaatgggactactcggaca
tagtatcacccattaaaacagcaattcgcaaaatgccagcccttcgttgcaaacctgatccaacactccctaaaaaccat
aacatctctcatcaactgttacatgaagtggtattttg
back to top
>AB289875.1-S-RNase503
tattttcaatttgtgcaacaatggccgccgaccaactgcaaaattcgcacgaaatgctccaaaccccggccatcacaaat
gttcaccatccatggcctatggccaagtaattattcaaacccaaagatgcccagtaattgcatggggtcgcgatttaacg
aaagtaacttgtctcctaaattgcgatccaaactgaagagatcttggccggacgtggaaagtggcaatgatacaaaattt
tgggaaggcgaatggaacaagcatggtaaatgttccgaacagacacttaaccaaatgcaatacttccagcgatcccacga
aatgtggtatacgtccaatatcacaagtatccttaaaaacgcttcaatcgtaccaagtgcgacacgatggaagtactcgg
acatagtatcagccattaaaacagcaactaaaagaacacccctccttcgttgcaaaactgaggcagcaactaatactgag
ttgttacatgaagtggtattttg
back to top
>AB289874.1-S-RNase512
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcaaaat
ttgaggacaggaaagtgtaccctaaattgcgagccaaactgaagaaatcttggccggacgtggaaagcggtaatgataca
agattttgggaaggcgaatggaacaaacatggtacatgttccgaacagacacttaaccaaatgcaatacttcgagagatc
ccacgcattttggaacatgcgcaatattacagaaatccttaaaaacgcttcaatcgtaccaagtgcgacacagacatgga
gctacgcggacatagtatcacctattaaagcagcaactcaaaaaacacccctccttcgttgcaaaagtaatccagcaact
aatactgagttgttacatgaagtggtattttg
back to top
>AB289873.1-S-RNase515
tattttcaatttgtgcaacaatggccaccggtcacctgcagatttagcagcagaactcgctaccaacaccggccattaca
aattttcaccatccatggcctatggccaagtaactattcaaacccaacgatgcccagtaattgcattgggttgcaattta
agaaagagaacgtgtcccctcaattgcgagccaaactggagagatcttggccaaacgtggaaagtcgcaatgatacaagg
ttctgggaaggcgaatggaacaaacatggtacatgttcccaacagacacttaaccaaatgcaatacttccagcgatccta
cgcaatgtggagatcctacaatattacagagatccttaaaaacgcctcaatcgttccaagtgcgacacaaacatggaagt
actcagacatagtatcacccattaaagcagtaactaaaacaacacccgtccttcgttgcaaacctgatccagttgatcct
aagaagtttcagctgttacatgaagtggtattttg
back to top
>AB289872.1-S-RNase503
tattttcaatttgtgcaacaatggccgccgaccaactgcagagctcgcaggagaccttgctctaaaccccggccattaca
aaacttcaccatccatggcctatggccaagtaattactcaaacccaacgatgcccagtaattgcaaagggtcacaatttg
aggcaaggaaagtgtaccctcaattgcaatccaatctgaagatagcttggcccgacgtggaaagtggcaatgatacaagg
ttttgggaaggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatatttcgagcgatctta
cggaatgtggaaatcctataatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggactt
acgcggacatagtatcacccattaaaacagcaactaaaagaacacccctccttcgttgcagacaggataagaatactcag
tggttacatgaagtggtattttg
back to top
>AB289871.1-S-RNase503
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcaataaaccttgctctaaaccccggccattaca
aaacttcaccatccatggcttatggccaagtaattattcaaacccaacgatgcccagtaagtgcactgggtcgcaattta
agaaagagaatgtgtaccctcaattgcgatccaaaatgaagatatcttggcccgacgtggaaagtggcaacgatacaagg
ttctgggaaagcgaatggaacaaacatggtacatgttccgaagatacacttaaccaggtacagtacttccagcgatccca
cgcaatgtggagatcacacaatgttacagagatccttagaaacgcttcaatcgtaccacatccgacacaaacatggagct
actcggatatagtatctcccattaaaacagcaactaaaagaacacccctccttcgttgcaaatacgacaagaagactcag
ttgttacatgaagtggtattttg
back to top
>AB289870.1-S-RNase521
tattttcaatttgtgcaacaatggccaccgacgacctgcagacttagcagcaaaccttccaaccaacaccggccattaca
aagattcactatccatggcctatggccgagtaactattcaaacccaaggaagcccagtaattgcaatggttcgcaattta
agggaatagtgtcccctaaattgcgaagcaaactgaagatagcgtggcccgacgtggaacggggcaatgatacaaaattt
tgggaagacgaatggaacaaacatggtacatgttccgaacagacgattaaccaaatgcaatacttcgagcgatcctacga
aatgtggaactttcgcaatattactgaggtccttaaaaacgcttctatcgtaccaagtgcgacacaaacatggacgcact
cagacattgtatcagccattaaaacagcaactaaaacaacaccttcccttcgttgcaaacctgacccagcacagaataag
agcgggccgaagactcagttgttacatgaagtggtattttg
back to top
>AB289869.1-S-RNase512
tattttcaatttgtgcaacaatggccaccggccacctgcagatttagccggaaacctgccaacaaacaccggccattaca
aattttcaccatccatggcctatggccaagtaattattcgaacccacggaggcccagtaattgcaatgggtcgcaattta
aggacgggaaagtgtaccctcagttgcgatccaaactgaagaaatcttggccggacgtggaaagtgggaatgacacaaaa
ttttgggaaggcgaatggaacaaacatggtacatgttctgaagagaaactaaaccaaatgcaatacttcgagagatccca
caacatgtggaggtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagct
actcggacatagtatcacccattaaaacagcaactggaagaacacccacccttcgttgcagaactgatccagcacaccca
aatattgactttttacatgaagtggtattttg
back to top
>AB289868.1-S-RNase497
tattttcaatttgtgcaacaatggccaccaaccaactgcaaatttcgtaaatgctccaaaccccggcctttacaaagatt
caccatccatggcctatggccaagtaactattcaaacccaacgaggcccagtaattgcactggattgcaatttgaggcaa
ggaaagtgtaccctcagttgcaatccgatctgaagatatcttggcccgacgtggaaagtggcaatgatacaaaattttgg
gaagacgaatggaacaaacatggtaagtgttccgaacagacacttaatcaaaggcaatacttcgagcgatcccacgcaat
gtggacctcgttcaatattacggagatccttcaaaacgcttcaatcgtaccacatccgacaaaaacatggagctactcgg
acatagtagcacccattaaaacagcaactgaaagaacacccctccttcgttgcaaactggataagaagactcagttgtta
catgaagtggtattttg
back to top
>AB289867.1-S-RNase512
tattttcaatttgtgcaacaatggccaccagccacctgcatacgtagcaggaaaccttgctccaaacacctgccattacc
aattttcaccatccatggcttatggccaagcaattattcaaacccaacgatgcccagtaattgcattgggccgctattta
acgaaagtaaattgtgccctaaattgcggtccaaactgaagatatcttggcccgacgtggaaagtggcaatgatacacaa
ttttgggagggtgaatggaacaaacatggtagatgctccaaagagatgcttaaccaaatgcaatacttcgagcgatccca
cgcaatgtggaactcgcacaatattacaaatatcctagaaaacgctcaaatcgtaccaaatgcgacacgaaaatggaagt
acttggacatattaacacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacctgatccagcacagtct
aactctcaattgttacatgaagtggtattttg
back to top
>AB289866.1-S-RNase497
tattttcaatttgtgcaacaatggccaccgaccaactgcatagttcacacgaaatgctccaaaccccggccgttgcaaat
cttcaccatccatggcctatggccaagtaattattcgaacccaacgaagccaagtaattgcgctgggtcggtatttgaaa
gattgccccctgaattgcaaaccaaactgaagatatcttggcccgacgtggaaagtggcaacgatacattattttgggaa
aaggaatggaacaaacatggtacatgttccgaggggatgcttaaccaaatgcaatacttcgagcgatcctacgcaatgtg
gatgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgcgacacaaacatggaagtactcggaca
tagtatcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaagcgcgataagaagaacacccagttgtta
catgaagtggtattttg
back to top
>AB289865.1-S-RNase509
tattttcaatttgtgcaacaatggccgccgacaaactgcagagttcgcaagagaccttgctctaaacctcggccattaca
aaacttcaccatccatggcctatggcctagtaattattccaacccaacgatgcccagtaagtgcactgggtcgcaattta
agaaagagaatgtgtaccctcaattgcgatccaagctgaagatatcttggcccgacgtggaaagtggcaatgatacaaga
ttctgggaaagcgaatggaacaaacatggtagatgttccgaacagacacttagccaggtgaaatacttccaacgatccca
cgcaatgtggagatcacataatgttacagagatccttagaaacgcttcaatcgtaccacatccaacacaaacatggacct
actccgatatagtatcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacgtgatccaacaactaat
actgaattgttacatgaagtggtattttg
back to top
>AB289864.1-S-RNase530
tattttcaatttgtgcaacaatggccaccgaccacctgcagaattcgcaagaaatgctcccggcaaatacaaatgttcac
catccatggcctctggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcaatttgaggcaagga
aagtgtaccctgatttgctatccgatctgaaaagatcttggcccgacgtggaaagtggcaatgaaacaaggttttgggaa
ggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagcgatcccacgacatgtg
gacgtcgtacaatattgcagatatccttaaaagcgctcaaatcgtaccacatgcgacacgaacatggaagtactcggaca
tagtatcaaccattaaaacagcaactcaaacaacacccctccttcgttgcaaacctcatccaaagagccaggccaagtct
catccaaagaccccggccaactctcagttgttacatgaagtggtattttg
back to top
>AB289863.1-S-RNase515
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccatgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgcaatgggtcaaaat
ttgacgcaaggaaagtgtcccctcgattgcgatccaaagtgacgagatcttggccggacgtggaaagtggcaatgacaca
agattttgggaaggcgaatggaacaaacatggtacgtgttccgaacggatacttaaccaaatgcaatacttccagcgatc
ccacgagatgtggacttcgcacaatattacagagatccttaaaaacgcttccatcgtaccacatccgacacaaacatgga
cctactccgacatagcatcacccattaaaacagcaactaaaagaacacctctccttcgttgcaaacgtgatccagcacgc
ccaaatgttcagttgttacatgaagtggtattttg
back to top
>AB289862.1-S-RNase515
tattttcaatttgtgcaacaatggccaccgaccacctgcagagttcagaagaaatgctctaaaccccggccattacaaaa
cttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcgatttaaga
aagagctattgtcccctcgaatgcaatccaaactgaagatatcttggccgaacgttgtaagtagcaatgatacaaaattt
tgggaaagtgaatggaacaaacatggtacttgttccgaacagacacttaaccaagtgcaatacttcgagatatcccacga
aatgtggaactcgttcaatattacagatatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagtact
cggacatagtatcagccattaagagtaaaactcaaagaacacccctccttcgttgcaaaactgatccagcacatcctaac
gcgaatactcagttgttacatgaagtggtattttg
back to top
>AB289861.1-S-RNase524
tattttcaatttgtgcaacaatggccaccgaccaactgcagagtccgcaataaaccttgctccaaacaccggtcattacc
aattttcaccatccatggcctatggccaagtaattattcaaacccaaagacgcctagtaattgcaatgggtcgcaatttg
acgcaattaaattgtcccctcgattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaatgatgaaggg
ttttgggaaggcgaatggaacaaacatggtaaatgttccgaacagacacttaaccaaatgcaatacttcgagcgatccca
cgaaatgtggatttttcacaatattacgaagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatggaagt
acacggacatagtatcagccattaaagcactaactcaaacaacacccctccttcgttgcaaacgtgatccagcacaggtt
aagggccagccgcagtctcagttgttacatgaagtggtattttg
back to top
>AB289860.1-S-RNase506
tattttcaatttgtgcaacaatggccaccgaccaactgcagagtccgcaataaaccttgctccaaaccccggccattaca
aatcttcaccatccatggcctatggccaagtaatcattcaaacccaacgatgcccagtaattgcaatgggacgcaattta
agcgaatattgtcccctgatttgcgatccgatctgacgagatcttggccggacgtggaaagtggtgatgatacaaaattt
tgggaaggcgaatggaacaagcatggtaaatgttccgaacagacacttaatcaaatgcagtacttccagcgatcccacga
aatgtggtacgcgttcaatattacaaagatccttaaaaacgcttcaatcgtaccacatgctacacaaacatggacctact
ccgacatagtagcacccattaaaacagcaactaagagaacacccctccttcgttgcaaatacgataagaagactcagttg
ttactcttacatgaagtggtattttg
back to top
>AB289859.1-S-RNase506
tattttcaatttgtgcaacaatggccagtgaccaactgtagagttcgcatcaagaaaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacggagcccagtaattgcaatgggacgaaat
ttgacgacaggaaagtgtaccctcatatgcgatccaaactgaggatatcttggcccgacgtggaaagcggcaatgataca
aatttttgggaacgcgaatggaacaagcatggtacgtgttccgaacggacacttaaccaattccaatacttcgagcgatc
ctacgaaatgtggagatcgcacaacattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
cgtactcggacatagtatcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaatacgataaaaacact
cagttgttacatgaagtggtattttg
back to top
>AB289858.1-S-RNase512
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaacccccggccgtt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaaatgcactgggtcgaaat
ttaactttacgaaagtgttcccttatttgcgatccaacctgaagaaatcttggccggacgtggaaagtggaaatgataca
aaattttgggaaggcgaatggaacaaacatggtacatgttcctcacggatacttaaccaaatgcaatacttccaacggtc
ccacgcaatgtggaaatcacacaatattacagagatcctaaaaaacgcttcaatcgtaccaagtgcgacacagacatgga
cctactccgacatagtagcacccattaaaacagcaaccaagagaacacccgtccttcgttgcaaaagtgatccagcaact
aataccgagttgttacatgaagtggtattttg
back to top
>GU997632.1-S-RNase.m1684
atggcgatgttgaagtcgtcacccgctttccttgttcttgctttggtcttgttctggtgtttcagtacgagcactggatc
ttatcaatattttcagtttgtgcaacaatggccgccaaccacctgcgcaattagcaaaaaaccttgctaccaaaacccgc
cctcaatcttcaccatccatggcctatggccaagtaattattcaaaaaacgcttgggtggctaattgcagtccaacgcga
tttaacaatagtttgtctcctaggttggaaaccaaactgaagatatcttggcccgacgtggaaagtggcaattatacaga
cttttgggaacgtgaatggaacaaacatggcacatgttccgaacaaacacttgaccaagaacaatacttcgagcgatccc
acgatatttggaacgcatacaatataacaaatatccttaaaagggctaaaatcctaccaactggggggaaatgggactac
tcggacatagtatcacccattaaaacagcaattcgcaaaatgccagcccttcgttgcaaacctgatccaacactccctaa
aaaccataacatctctcatcaactgctacatgaagtggtgctttgtttgcattataatggaagagctctgattgactgta
acaacccatcatgcaaaaataaccttaagatcttgttccaataa
back to top
>GU968646.1-S-RNase.m1717
atggcggtgttgaaatcgtcacccgctttccttgttcttgcttttgctttcttcttgtgtttaattatgagcactggatc
ttacgcctattttcaatttgtgcaacaatggccaccgaccacttgcagaattagcaataaatcttgccaccaacagcgac
cgttacaaatgttcaccatccatggcctatggccaagtaattattcaaacccaaggaagcccagtagttgtaccgggtcg
caatttaagttagagaaattgtacccaaaattgcgatccaaactgaagatatcttggcccaacgtcgaaagcgggaatga
taccaagttttgggaatccgaatggaacaaacacggtacgtgttccgaacagacacttaaccaattccaatacttccagc
gatcccacggaatctggaacgcgtacaatatgacaaatatccttaaaagggctcaaatcataccaagtgcgacaaatacg
tggaagtactcggacattgtatcacccattaaagcagtaactaaaactacacccttacttcgttgcaaacatgatccaaa
accgcttcagagccatccagcacagtctaagagccggccgaagcctcagttgttacatgaagtggtactttgttttgatt
atgatgcgttaaagcagattgactgtaatcgaacagcaggatgcctgaatcaagttgacatcttgtttcctcaataa
back to top
>GU968645.1-S-RNase.m1684
atggcggtgttgaaatcgtcactcgctttcattgttcttgcttttgctttcttcttgtgtttcattatgagcgctggatc
ttatgactattttcaatttgtgcaacaatggccaccgaccaactgcaaagttcgcgggaaaccttgctccaaaccccggc
cattacaaatcttcaccatccatggcctatggccaagtaattattcaaacccaacgaggcctagtaattgcattggatcg
ctatttgaggaagggaaattgtaccctcagttgcgattgaatctgaagagatcttggcccgacgtggaaagtggcaatga
tacaaaattttggtcaggtgaatggaacaaacatggtagatgttcggaacagacacttaaccaaaggcaatacttcgagc
gatcccacgcgatgtggaactcatacaatattacaaatatcctagaaaacgctcaaatcgtaccaaatgcaacacaaaca
tggaagtactcggacatagtatcacccattaaaacagcaactggaagaacacccctccttcgttgcaaatctgatccaaa
aaagtcaaacaattatcagttcttacatgaagtggtattttgttatgggtatagagcaaaaaagcagattgactgtaatc
gaacagcaggatgctggaataatgttgacatcaagtttgagtaa
back to top
>GU968644.1-S-RNase.m1681
atggggatgctgaaatcgtcactcgctttccttgttcttgttcttactttcttcttgtgtttcattatgagcgctggatc
ttacgactattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaccccc
ggccattacaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccaataaatgcactggg
tcgaaatttaactttacgaaagtgttcccttatttgcgatccaacctgaagaaatcttggccggacgtggaaagtggaaa
tgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttcctcacggatacttaaccaaatgcaatacttcc
aacggtcccacgcaatgtggaaatcacacaatattacagagatcctaaaaaacgcttcaatcgtaccaagtgcgacacaa
acatggacctactccgacatagtagcacccattaaaacagcaaccaagagaacacccgtccttcgttgcaaaagtgatcc
agcaactaataccgagttgttacatgaagtggtattttgttatgaatataatgcattaaagctgattgactgtaatcgaa
cagcaggatgcaaaaatcaacaacgcatctcgtttcaatag
back to top
>AB289902.1-S-RNase.m1506
tattttcaatttgtgcaacaatggccatcgaccaactgcagagttcgcatcaagctaccttgctcccacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattactcaaacccaacgaagcccagtaattgcgctgggtcgcaat
ttagctttactaaagtgtaccctcaattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaatgataca
aagttttgggaaggcgaatggaacaagcatggtacatgttccgaccagacacttaatcaaatggattactttgagacatc
ccacgacatgtggatgtcgtacaatatcacggagatccttaaaaacgcttcaatcgtaccaagtgcgacgaaaacatgga
agtactcggacatagtatcacccattaaaagagcaactggaagaacacccacccttcgctgcaaatacgataagaagatt
cagttgttacatgaagtggtattttg
back to top
>AB289901.1-S-RNase.m1506
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaacccccggccatt
acagtatttcaccatccatggcctatggccaagtaattattcaaacccaacgaggcctagtaattgcaatgggtcgaaat
ttaactttacgaaagtgtaccctcaattgcgaaaagatctgaagaaatcttggccggacgtggaaagtggcaatgataca
aaattttgggaaggcgaatggaacaaacatggtacatgttccgaagagtcacttaaccaaatgcaatacttcgagcgatc
ccacgaaatgtggagctcgtacaatattacggagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
agtactcggacatagtagcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacaggacaagaagact
gagttgttacatgaagtggtattttg
back to top
>AB289900.1-S-RNase.m1527
tattttcaatttgtgcaacaatggtcaccgatcaactgcagagttcgcatcaagaaaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaggtaattattcaaacccaacgatgcccagtaattgtaatgggtcgcaat
ttgaggacaggaaagtgtaccctcaactgcggaccaaactgaagaaatcttggcccgacgtggaagatggcaatgataca
aagttttgggaagccgaatggaacaagcatggtacatgttccgaacagacgcttaaccaaatgcaatacttcgaggtatc
ccaggacatgtggagatcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatgga
agtactcggacatagaatcacccattaaaacagcaactaaaagaacacccatccttcgttgcaaacgtgatccagcatgg
aataagaccgggccgaggactcagttattacatgaagtggtattttg
back to top
>AB289899.1-S-RNase.m1503
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcaataaaccttgtaccaaaccccggccattaca
aaacttcaccatccatggcctatggccaagtaattattcaaacccaaggatgcccagtaagtgcactgggtcgctattta
actttaggaaagtgtaccctcaattgcgttccgatctgaagatatcttggccagacgtggaaagtggcaatgatacaagg
ttttgggaaagcgaatggagcaaacatggtagatgttccgaagactcacttaaccaaatgcaatacttcgagcggtcgca
cgcaatgtggatatcgtacaatatcacagagatccttaaaaacgcttcaatcgtaccgagtgcgacaaaaaactggacct
actcggacatagtatcacccattaaaagagcaactaaaagaacacccctcctccgttgcaaatacgataagagcactcag
ttgttacatgaagtggtattttg
back to top
>AB289898.1-S-RNase.m1548
tattttcaatttgtgcaacaatggccaccggccacttgcatacgtagcacgagaccttgctccaaacaccggccattaca
aattttcaccatccatggcctatggccaagtaattactcaaagcccacgatgcccggtaattgcgttgggtcggaattta
agatggataacttgtctcctaaattgcgatccaaactgaagatatcttggcccgacgtggaaaggagcaatgatacagag
ttttgggaaggagaatggactaaacatggaacttgttccgaacaggcacttaaccaattccaatacttccagcgatcaga
ctcaatgtggagatcgcacaacattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagct
actccgacatcgtatcacccattaaaaaagcaactaaaagaacacccctccttcgttgcaaacctgatccagcactgcct
aagaagagccaacgagcacaacctaatagcccgccacagtctcagttgttacatgaagtggtattttg
back to top
>AB289897.1-S-RNase.m1506
tattttcaatttgtgcaacagtggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaatccccggccatt
acaatatttcaccatccatggcctatggcctagtaattattcaagcccaacgaagcccagtaattgcaatgggtcgcaat
ttgatacaaggaaagtgtcccctaaaatgcgaatcaagctgaagaaatcttggccagacgtggaaagtggcaatgataca
agattttggaaagacgaatggaacaaacatggtacatgttccgaagagagacttaaccaaatgcaatacttcgagcgatc
ccacgatatgtggttgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
catactcggacatagtatcacccattaaaacagcaactggaagaacacccacccttcgctgcaaacaggataagaagact
cagttgttacatgaagtggtattttg
back to top
>AB289896.1-S-RNase.m1542
tattttcaatttgtgcaacaatggccaccgaccaactgcataattcgcacgaaatgctccaaaccccggccattacaaat
gttcaccatccatggcctatggccgagtaattattcaaacccaacgatgcccagtaattgcaatggagcgcattttgaga
acaggaaagtgtaccctcaattgcgatccaaactgaagaggtcttggccagacgtggaaagtggcaacgatacaaacttc
tgggaaagagaatggaacaaacatggtaaatgttccgaacagacactgaaccaaatgcaatacttcgagcgatcccacga
aatgtggaaatttcacaatattacggagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacctact
ccgacatagtatcagccattaaagcagtaacccaaacaacaccctaccttcgttgcaaaccacatccaacaaagcctaag
agccatccatcacagcgtaagagccaaccgaaacttcagttgttacatgaagtggtattttg
back to top
>AB289895.1-S-RNase.m1521
tattttcaatttgtgcaacaatggccaccgaccaactgcaaaattcgcaagaaatgctccaaacccctgccattgcaaat
gttcaccatccatggcctatggccaagtaatcattcaaacccaacgacgcccagtaattgcagtggggcgcaatctgatg
acaggaaagtgtacccccgattgcgatccaaactgaagatatcttggccggacgtggaaaatggcaatgatacaaaattt
tgggaaggagaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagcgatcctacga
aatatggaacttgttcaatattacgaatatccttaaaaatgcttcaatcgtaccaagtgcgacacaaacatggacctact
ccgacatagtatcaaatattaaagcagtaactcaaagaacacccctccttcgttgcagacgcaatccagcatataataag
agcgggccgagctctcagttgttacatgaagtggtattttg
back to top
>AB289894.1-S-RNase.m1548
tattttcaatttgtgcaacaatggccaccgaccacctgcagagttaggaataaaccttgctccaaactccggccgttaca
aattttcagcatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcaatttg
agggagggaaagtgtcccctcgattgcaatccaagctgaagatatcttggcccaacgtggaaagtaccaatgatacaaaa
ttttgggaaggcgaatggaacaaacgtggtacatgttccgaacagacacttaaccaaatacaatacttcgagcgatcaca
cgacatgtggatgtcgcataatatgacaaagatatttcaaaacgcttcaatcgtaccgcatccgacacaaacatggaaat
acagggacatagtatcatccattaaagcagtaactcaaacaacaccctcccttcgttgcaaacctgattcagcacagcct
aagagccataagagccatccagcacagcctaagagtcggtctcagttgttacatgaagtggtattttg
back to top
>AB289893.1-S-RNase.m1506
tattttcaatttgtgcaacaatggccaccgatcacctgcagatttagccggaaaccttcctacaatcaccggccattaca
aaatttcaccatccatggcctctggccaagtaactattcaaacccatggaggcccagtaattgcactgggacgcaattta
aacaattgtcccctcaattgcgatccaaactaaagatatcttggcccgacgtggaaggtggcaatgatacaaggttttgg
gaaatggaatggaacaaacatggtacatgttccgaagagtcacttaaccaaatgcaatacttccagcgatccttcgcaat
gtggagatcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatggaagtactcgg
acatagtatcacccattcaaacagcaattaaaagaacacccctccttcgttgcaaacgtgacaaagcacacccgaatatt
cagtggttacatgaagtggtattttg
back to top
>AB289892.1-S-RNase.m1509
tattttcaatttgtgcaacaatggccaccgacgacctgcagatttagcagcaaaccttccaaccaacagcggcgattaca
aatcttcaccatccatggcctatggccaagtaattattcaaacccaaggatgcctagtaattgcactgggtcgcaattta
actttacgaaagtgtaccctcaattgcgatccaaactgaagaaatcttggccggacgtggaaagtggcaatgatacaaga
ttttgggaaagcgaatggaacaaacatggtacatgctccgaagagaaacttaaccaaatgcagtacttcgagcgatccca
cgaaatgtggaactttcacaatattacaaagatccttgaaaacgcttcaatcgtaccaagtgcgacacaaaagtggagct
actcggacatagtatcagccattaaagcaagaactcaaacaacaccctcccttcgttgcaaacgggataagaagactcag
ttgttacacttacatgaagtggtattttg
back to top
>AB289891.1-S-RNase.m1506
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcaaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgtaatgggtcaaaat
ttgacgcaaggaaagtgtcccctcaattacgaaacaaactgaagatatcttggccggacgtggaaagtggcaatgataca
aaattttgggaaggcgaatggaacaaacatggtacatgttccgagcagacacttcaccaaatgcaatacttcgagctatc
ccacgacatgtggctgtcccacaatattacagaaatccttaaaaacgcttcaatcttaccacatccgacacaaacatgga
cgtactcggacatattatcacccattaaagcagcaactaaaagaacaccccttcttcgttgcaaacgggataagaacact
cagttgttacatgaagtggtattttg
back to top
>AB289890.1-S-RNase.m1542
tattttcaatttgtgcaacaatggccaccgaccacctgcagactgagcacgaaacctagcaacaaacatcggccattaca
aaatttcaccatccatggcctatggccaagtaattattcaaacccaaagatgcccagtaattgcgctgggtcgcaattta
agaaaatattgtcccctaaactgctaaccaaactgaagagatcttggcccgacgtggaaaaaggcaatgatacagaattt
tgggaaagcgaatggaacaaacatggtacttgttccgaacagacatttaaccaaatgcagtacttcaagcgatcccacga
aatgtggagctcgtacaatattacacacatccttaaaaatgcttcaatcgtaccaagtgcgacacaaacatggacctact
cggacatagtatcagccattaaaacagtaactcaaacaacacctctccttcgttgcaaaccttatccagcacagcctaaa
agccatccagcacagcgtaagagcctgccgaagcctcagttgttacatgaagtggtattttg
back to top
>AB289889.1-S-RNase.m1512
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcggatcaagcgaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgcggcccagtaattgcaatgggtcacaat
ttgacgcaaggaaagtgtacccccgattgagatccagactgaatagatcttggccggacgtggaaagtggcaatgataca
aaattttgggaaagcgaatggaataaacatggcacatgttcccaacggatacttaaccaatacctatacttcgagcgatc
ccacgaaatgtggagatcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgcgacacaaacatgga
cctactcggacatagtagcacccattaaagcagcaactaaaagaactcccctcctccgttgcaaaactgatctagcaact
aatactgagttgttacatgaagtggtattttg
back to top
>AB289888.1-S-RNase.m1524
tattttcaatttgtgcaacaatggccaccggccacctgcatacgtagcacgaaaccttgctccaaacaccggccattaca
aattttcaccatccatggcctatggccaagcaattattcaaacccaaagatgcccagtaattgcgtcgggtcgcaattta
acgaaagtaaattgtaccctcaattgcgatccagactgaagaggtcttggccagacgtggaaagtggcaatgatacaaag
ttttgggaaggcgaatggaacaaacatggtacgtgttccgaacagatacttgaccaaatccaatacttcgagcgatctca
cgaaatgtggaactcgttcaatattacgcatatccttaaaaacgcttcaatcgtaccaagcgctacacaaacatggaagt
actcggacatagtatcagccataaaagcagtaactaaaagaacccccgcccttcgttgcaaaagcaatccaactcagcct
aagggccaagcgaagactcagttgttacatgaagtggtattttg
back to top
>AB289887.1-S-RNase.m1530
tattttcaatttgtgcaacaatggccaccaaccacctgcgctgttaggaaaacaccttgctatcaaaacccgccatcaaa
aatcttcaccattcatgggctttggccaagtaattattcgaaaaacgcttgggtggctaattgcaatgggacccgattta
gcaatagtttgtctcctgcactggagtccaaactgaagaaatcttggcccgacgtggaaagtggcaacgatacagacttt
tggggacgtgaatggaacaaacacggtacatgttccgaacaaacacttgaccaggaactatacttccaacggtcccacat
tatttggaaagcattcaatatcacaaatatacttcaaaacgctaaaatcctaccaaatgggtcaaaatgggactacgcag
acatagcatcacccattaaagcagttactaccaaaatgcccactctccgttgcaaacctgatccaacacagcctaaaaac
cctaacaacctgacgatgtctcatcagctgttacatgaagtggtattttg
back to top
>AB289886.1-S-RNase.m1530
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgaacgaaatgctccaacccccggccattacaaat
cttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcattgggtcgcaatttaacg
aaagtaaactgtaccctcatttgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaacgatacagacttc
tggggaaaagaatggaacaaacatggtaaatgttccgaacagacacttaacctaatgcaatacttccagagatcccacga
aatgtggaattcgttcaatattacagatatccttaaaaaagcttcaatcgtaccaagtccgaaccaaacatggacctata
cggacatagtatcagcccttaaaacaagaaccaaaagaactcccctccttcgttgcaaacctgatccaaaggcgaagtct
cagcctacaagccagcccaagcctgagttgttacatgaagtggtattttg
back to top
>AB289885.1-S-RNase.m1515
tattttcaatttgtgcaacaatggccaccgaccagctgcaaagttcgcgggaaaccttgctccaaaccccggccattaca
aatcttcaccatccatggcctatggccaagtaattattcaaacccaacgaggcctagtaattgcattggatcgctatttg
aggaagggaaattgtaccctcagttgcgattgaatctgaagagatcttggcccgacgtggaaagtggcaatgatacaaaa
ttttggtcaggtgaatggaacaaacatggtagatgttcggaacagacacttaaccaaaggcaatacttcgagcgatccca
cgcgatgtggaactcatacaatattacaaatatcctagaaaacgctcaaatcgtaccaaatgcgacacaaacatggaagt
actcggacatagtatcacccattaaaacagcaactggaagaacacccctccttcgttgcaaatctgatccaaaaaagtca
aacaattatcagttcttacatgaagtggtattttg
back to top
>AB289884.1-S-RNase.m1518
tattttcaatttgtgcaacaatggccaccaaccacctgcgcacttagcaaaaatccttgctaccaaaacccgccctcaat
cttcaccatccatggcctatggccaagtaattattcaaaaaacgcttgggttgctaattgcagtccaaagcgatttagca
atagtttggctcctaaattggaggccaaactgaagatatcttggccgaacgtggaaaatggcaatgatacagagttttgg
gaacgtgaatggaacaagcatggcacatgttccgaacaaacactagaccaagaactgtacttccagcgatcccaccatat
ttggaacgcatacaatatcacaggtatccttaaaaatgctaaaatcctaccaaatggggcaaaatgggactactcagaca
tagtatcacccatcaaaacagcaactcgcaaaatgcccgcccttcgttgcaaacctgatccaacactgcctaaaaacaat
accatgtctcatcagctgttacatgaagtggtattttg
back to top
>AB289883.1-S-RNase.m1527
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaatccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcattgggtcgcaat
ttaactttacgaaagtgtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaatgataca
aggttttgggaaggcgaatggaacaaacatggtacatgttcggaagattcacttaaccaaatgcaatacttcgagcgatc
ccacgaaatgtggtattcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
agtactcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatccagcacag
aataagagtgggccgaagactcagttgttacatgaagtggtattttg
back to top
>AB289882.1-S-RNase.m1524
tattttcaatttgtgcaacaatggccaccggctacctgcagacttagcaggacaccttgctacaaaccccggccacctca
aatcttcaccatccatggcctatggccaagtaactattcaaacccaaagaggcccagtaattgcagggggtcgctatttg
atttaaggaaagtgtaccctcagttgcgattgaatctgaagatatcttggcccaacgtgaaaagtggcaatgatacagaa
ttttgggaaagcgaatggaacaaacatggtagatgttccgaacagacactcaaccaaatgcaatacttcgagcgatcaga
cgaaatgtggaactcttacaatattacggagatccttaaaaaagctcaaatcgtaccaaatgcgacacggacatggaagt
acacggacatattatcacccattaaagcagcaactaacacaacacccatccttcgttgcaaacctgatccatcgcagcct
aagagcccccaaaagcctcagttgttacatgaagtggtattttg
back to top
>AB289881.1-S-RNase.m1503
tattttcaatttgtgcaacaatggccaccgactaactgcagagttcgcaataaaccttgctccaaaccccggccattaca
aatcttcaccatccatggcctatggccaagtaattattcaaacccaaggaggcctagtaattgcgctgggtcgccattta
actttacgaaagtgtaccctcatatgcgatccaaactgaagatatcttggcctgacgtggaaagtggcaatgatacaaaa
ttttgggaaggcgaatggaacaaacatggtacatgttctgaagagagacttaaccaaatgcaatacttcgagcgatccca
cgacatgtggatgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagt
actcggacatagtatcacccattaaaaaagcaactggaagaacacccctccttcgttgcaaatacgataagagcactcag
ttgttacatgaagtggtattttg
back to top
>AB289880.1-S-RNase.m1521
tattttcaatttgtgcaacaatggccaccgactaactgcatagtgcatacgaaatgctccaatccccggccattacaaat
gttcaccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgcaatgggtcaaaatttgatg
caaggaaagtgtaccctcaattgcaatccaaactgaagaagtcttggcctgacgtggaaagtggcaatgatacgaaattt
tgggaaggcgaatggaataaacatggtacatgctccgaacagacactcaaccaataccaatacttcgagatatcccacga
catgtggtattcgttcaatattacaaacatccttaaaaacgcgtcaatcctaccaagtacgacacaaacatggacctact
ccgacatagtagcacccattaaaacagtaactaaaagaacacccctccttcgttgcaaacgcgatccagcacggaataag
agcctgccgaactatcagttgttacatgaagtggtattttg
back to top
>AB289879.1-S-RNase.m1500
tattttcaatttgtgcaacaatggccgccgaccaactgcaaaattagcacgaaatgctccaaaccccgggcattacaaat
gttcaccatccatggcctatggccaagtaattattcaaacccaacgctgcccagtaattgccaagggtcgctttttgagg
caaggaaagtgtaccctcaattgcaaaccaaactaaagagatcttggcccgacgtggaaagaggcaatgatacaaaattt
tgggaaggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagctttcccacca
aatgtggatgtcgcataatattacagatatcctttatagggctcaaatcgtaccaaatgcgacaaaaacatggaactact
gggacatagtgtcacccattaaagcggcaactaatacaacaccactccttcgttgcaaagtggttaagaagactcagttg
ttacatgaagtggtattttg
back to top
>AB289878.1-S-RNase.m1539
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcaaatgctccaaaccccggctattacaaaactt
caccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgcatgggatcgcaatttaacgaaa
ggaatttgtcccctaaattgctaaacaaactgaagagatcttggcccgacgtggaaagtggcaatgatacaaacttttgg
gaacgcgaatggaacaaacatggtagatgttccgaacgtacatttaaccaaatgcaatacttcaagcgatcccacgaaat
gtggagctcgtacaatattacaggtatccttaaaaatgcttcaatcgtaccacatgcgacacagacatggacttactcgg
acatagtatcaaccattaaagcagcaactataacaacacctttgcttcgttgtaaacctgatcgagcacagcctaagagc
catccagcacagcctaagagcgggccgaagcctcagttgttacatgaagtggtattttg
back to top
>AB289877.1-S-RNase.m1524
tattttcaatttgtgcaacaatggccaccggccacttgcatacgtagcacaaaaccttgctccaaacaccggtcattacc
aattttcaccatccatggcctatggccaagtaattattcaaacccaaagacgcctagtaattgcaatgggtcgcaatttg
acgcaattaaattgtcccctcgattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaatgatgaaggg
ttttgggaaggcgaatggaacaaacatggtaaatgttccgaacagacacttaaccaaatgcaatacttcgagcgatccca
cgaaatgtggatttttcacaatattacgaagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatggaagt
acacggacatagtatcagccattaaagcactaactcaaacaacacccctccttcgttgcaaacgtgatccagcacaggtt
aagggccagccgcagtctcagttgttacatgaagtggtattttg
back to top
>AB289876.1-S-RNase.m1518
tattttcaatttgtgcaacaatggccgccaaccacctgcgcaattagcaaaaaaccttgctaccaaaacccgccctcaat
cttcaccatccatggcctatggccaagtaattattcaaaaaacgcttgggtggctaattgcagtccaacgcgatttaaca
atagtttgtctcctaggttggaaaccaaactgaagatatcttggcccgacgtggaaagtggcaattatacagacttttgg
gaacgtgaatggaacaaacatggcacatgttccgaacaaacacttgaccaagaacaatacttcgagcgatcccacgatat
ttggaacgcatacaatataacaaatatccttaaaagggctaaaatcctaccaactggggggaaatgggactactcggaca
tagtatcacccattaaaacagcaattcgcaaaatgccagcccttcgttgcaaacctgatccaacactccctaaaaaccat
aacatctctcatcaactgttacatgaagtggtattttg
back to top
>AB289875.1-S-RNase.m1503
tattttcaatttgtgcaacaatggccgccgaccaactgcaaaattcgcacgaaatgctccaaaccccggccatcacaaat
gttcaccatccatggcctatggccaagtaattattcaaacccaaagatgcccagtaattgcatggggtcgcgatttaacg
aaagtaacttgtctcctaaattgcgatccaaactgaagagatcttggccggacgtggaaagtggcaatgatacaaaattt
tgggaaggcgaatggaacaagcatggtaaatgttccgaacagacacttaaccaaatgcaatacttccagcgatcccacga
aatgtggtatacgtccaatatcacaagtatccttaaaaacgcttcaatcgtaccaagtgcgacacgatggaagtactcgg
acatagtatcagccattaaaacagcaactaaaagaacacccctccttcgttgcaaaactgaggcagcaactaatactgag
ttgttacatgaagtggtattttg
back to top
>AB289874.1-S-RNase.m1512
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcaaaat
ttgaggacaggaaagtgtaccctaaattgcgagccaaactgaagaaatcttggccggacgtggaaagcggtaatgataca
agattttgggaaggcgaatggaacaaacatggtacatgttccgaacagacacttaaccaaatgcaatacttcgagagatc
ccacgcattttggaacatgcgcaatattacagaaatccttaaaaacgcttcaatcgtaccaagtgcgacacagacatgga
gctacgcggacatagtatcacctattaaagcagcaactcaaaaaacacccctccttcgttgcaaaagtaatccagcaact
aatactgagttgttacatgaagtggtattttg
back to top
>AB289873.1-S-RNase.m1515
tattttcaatttgtgcaacaatggccaccggtcacctgcagatttagcagcagaactcgctaccaacaccggccattaca
aattttcaccatccatggcctatggccaagtaactattcaaacccaacgatgcccagtaattgcattgggttgcaattta
agaaagagaacgtgtcccctcaattgcgagccaaactggagagatcttggccaaacgtggaaagtcgcaatgatacaagg
ttctgggaaggcgaatggaacaaacatggtacatgttcccaacagacacttaaccaaatgcaatacttccagcgatccta
cgcaatgtggagatcctacaatattacagagatccttaaaaacgcctcaatcgttccaagtgcgacacaaacatggaagt
actcagacatagtatcacccattaaagcagtaactaaaacaacacccgtccttcgttgcaaacctgatccagttgatcct
aagaagtttcagctgttacatgaagtggtattttg
back to top
>AB289872.1-S-RNase.m1503
tattttcaatttgtgcaacaatggccgccgaccaactgcagagctcgcaggagaccttgctctaaaccccggccattaca
aaacttcaccatccatggcctatggccaagtaattactcaaacccaacgatgcccagtaattgcaaagggtcacaatttg
aggcaaggaaagtgtaccctcaattgcaatccaatctgaagatagcttggcccgacgtggaaagtggcaatgatacaagg
ttttgggaaggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatatttcgagcgatctta
cggaatgtggaaatcctataatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggactt
acgcggacatagtatcacccattaaaacagcaactaaaagaacacccctccttcgttgcagacaggataagaatactcag
tggttacatgaagtggtattttg
back to top
>AB289871.1-S-RNase.m1503
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcaataaaccttgctctaaaccccggccattaca
aaacttcaccatccatggcttatggccaagtaattattcaaacccaacgatgcccagtaagtgcactgggtcgcaattta
agaaagagaatgtgtaccctcaattgcgatccaaaatgaagatatcttggcccgacgtggaaagtggcaacgatacaagg
ttctgggaaagcgaatggaacaaacatggtacatgttccgaagatacacttaaccaggtacagtacttccagcgatccca
cgcaatgtggagatcacacaatgttacagagatccttagaaacgcttcaatcgtaccacatccgacacaaacatggagct
actcggatatagtatctcccattaaaacagcaactaaaagaacacccctccttcgttgcaaatacgacaagaagactcag
ttgttacatgaagtggtattttg
back to top
>AB289870.1-S-RNase.m1521
tattttcaatttgtgcaacaatggccaccgacgacctgcagacttagcagcaaaccttccaaccaacaccggccattaca
aagattcactatccatggcctatggccgagtaactattcaaacccaaggaagcccagtaattgcaatggttcgcaattta
agggaatagtgtcccctaaattgcgaagcaaactgaagatagcgtggcccgacgtggaacggggcaatgatacaaaattt
tgggaagacgaatggaacaaacatggtacatgttccgaacagacgattaaccaaatgcaatacttcgagcgatcctacga
aatgtggaactttcgcaatattactgaggtccttaaaaacgcttctatcgtaccaagtgcgacacaaacatggacgcact
cagacattgtatcagccattaaaacagcaactaaaacaacaccttcccttcgttgcaaacctgacccagcacagaataag
agcgggccgaagactcagttgttacatgaagtggtattttg
back to top
>AB289869.1-S-RNase.m1512
tattttcaatttgtgcaacaatggccaccggccacctgcagatttagccggaaacctgccaacaaacaccggccattaca
aattttcaccatccatggcctatggccaagtaattattcgaacccacggaggcccagtaattgcaatgggtcgcaattta
aggacgggaaagtgtaccctcagttgcgatccaaactgaagaaatcttggccggacgtggaaagtgggaatgacacaaaa
ttttgggaaggcgaatggaacaaacatggtacatgttctgaagagaaactaaaccaaatgcaatacttcgagagatccca
caacatgtggaggtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggagct
actcggacatagtatcacccattaaaacagcaactggaagaacacccacccttcgttgcagaactgatccagcacaccca
aatattgactttttacatgaagtggtattttg
back to top
>AB289868.1-S-RNase.m1497
tattttcaatttgtgcaacaatggccaccaaccaactgcaaatttcgtaaatgctccaaaccccggcctttacaaagatt
caccatccatggcctatggccaagtaactattcaaacccaacgaggcccagtaattgcactggattgcaatttgaggcaa
ggaaagtgtaccctcagttgcaatccgatctgaagatatcttggcccgacgtggaaagtggcaatgatacaaaattttgg
gaagacgaatggaacaaacatggtaagtgttccgaacagacacttaatcaaaggcaatacttcgagcgatcccacgcaat
gtggacctcgttcaatattacggagatccttcaaaacgcttcaatcgtaccacatccgacaaaaacatggagctactcgg
acatagtagcacccattaaaacagcaactgaaagaacacccctccttcgttgcaaactggataagaagactcagttgtta
catgaagtggtattttg
back to top
>AB289867.1-S-RNase.m1512
tattttcaatttgtgcaacaatggccaccagccacctgcatacgtagcaggaaaccttgctccaaacacctgccattacc
aattttcaccatccatggcttatggccaagcaattattcaaacccaacgatgcccagtaattgcattgggccgctattta
acgaaagtaaattgtgccctaaattgcggtccaaactgaagatatcttggcccgacgtggaaagtggcaatgatacacaa
ttttgggagggtgaatggaacaaacatggtagatgctccaaagagatgcttaaccaaatgcaatacttcgagcgatccca
cgcaatgtggaactcgcacaatattacaaatatcctagaaaacgctcaaatcgtaccaaatgcgacacgaaaatggaagt
acttggacatattaacacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacctgatccagcacagtct
aactctcaattgttacatgaagtggtattttg
back to top
>AB289866.1-S-RNase.m1497
tattttcaatttgtgcaacaatggccaccgaccaactgcatagttcacacgaaatgctccaaaccccggccgttgcaaat
cttcaccatccatggcctatggccaagtaattattcgaacccaacgaagccaagtaattgcgctgggtcggtatttgaaa
gattgccccctgaattgcaaaccaaactgaagatatcttggcccgacgtggaaagtggcaacgatacattattttgggaa
aaggaatggaacaaacatggtacatgttccgaggggatgcttaaccaaatgcaatacttcgagcgatcctacgcaatgtg
gatgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgcgacacaaacatggaagtactcggaca
tagtatcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaagcgcgataagaagaacacccagttgtta
catgaagtggtattttg
back to top
>AB289865.1-S-RNase.m1509
tattttcaatttgtgcaacaatggccgccgacaaactgcagagttcgcaagagaccttgctctaaacctcggccattaca
aaacttcaccatccatggcctatggcctagtaattattccaacccaacgatgcccagtaagtgcactgggtcgcaattta
agaaagagaatgtgtaccctcaattgcgatccaagctgaagatatcttggcccgacgtggaaagtggcaatgatacaaga
ttctgggaaagcgaatggaacaaacatggtagatgttccgaacagacacttagccaggtgaaatacttccaacgatccca
cgcaatgtggagatcacataatgttacagagatccttagaaacgcttcaatcgtaccacatccaacacaaacatggacct
actccgatatagtatcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacgtgatccaacaactaat
actgaattgttacatgaagtggtattttg
back to top
>AB289864.1-S-RNase.m1530
tattttcaatttgtgcaacaatggccaccgaccacctgcagaattcgcaagaaatgctcccggcaaatacaaatgttcac
catccatggcctctggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcaatttgaggcaagga
aagtgtaccctgatttgctatccgatctgaaaagatcttggcccgacgtggaaagtggcaatgaaacaaggttttgggaa
ggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagcgatcccacgacatgtg
gacgtcgtacaatattgcagatatccttaaaagcgctcaaatcgtaccacatgcgacacgaacatggaagtactcggaca
tagtatcaaccattaaaacagcaactcaaacaacacccctccttcgttgcaaacctcatccaaagagccaggccaagtct
catccaaagaccccggccaactctcagttgttacatgaagtggtattttg
back to top
>AB289863.1-S-RNase.m1515
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccatgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacggtgcccagtaattgcaatgggtcaaaat
ttgacgcaaggaaagtgtcccctcgattgcgatccaaagtgacgagatcttggccggacgtggaaagtggcaatgacaca
agattttgggaaggcgaatggaacaaacatggtacgtgttccgaacggatacttaaccaaatgcaatacttccagcgatc
ccacgagatgtggacttcgcacaatattacagagatccttaaaaacgcttccatcgtaccacatccgacacaaacatgga
cctactccgacatagcatcacccattaaaacagcaactaaaagaacacctctccttcgttgcaaacgtgatccagcacgc
ccaaatgttcagttgttacatgaagtggtattttg
back to top
>AB289862.1-S-RNase.m1515
tattttcaatttgtgcaacaatggccaccgaccacctgcagagttcagaagaaatgctctaaaccccggccattacaaaa
cttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcgcgatttaaga
aagagctattgtcccctcgaatgcaatccaaactgaagatatcttggccgaacgttgtaagtagcaatgatacaaaattt
tgggaaagtgaatggaacaaacatggtacttgttccgaacagacacttaaccaagtgcaatacttcgagatatcccacga
aatgtggaactcgttcaatattacagatatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagtact
cggacatagtatcagccattaagagtaaaactcaaagaacacccctccttcgttgcaaaactgatccagcacatcctaac
gcgaatactcagttgttacatgaagtggtattttg
back to top
>AB289861.1-S-RNase.m1524
tattttcaatttgtgcaacaatggccaccgaccaactgcagagtccgcaataaaccttgctccaaacaccggtcattacc
aattttcaccatccatggcctatggccaagtaattattcaaacccaaagacgcctagtaattgcaatgggtcgcaatttg
acgcaattaaattgtcccctcgattgcgatccaaactgaagagatcttggcccgacgtggaaagtggcaatgatgaaggg
ttttgggaaggcgaatggaacaaacatggtaaatgttccgaacagacacttaaccaaatgcaatacttcgagcgatccca
cgaaatgtggatttttcacaatattacgaagatccttaaaaacgcttcaatcgtaccacatccgacaaaaacatggaagt
acacggacatagtatcagccattaaagcactaactcaaacaacacccctccttcgttgcaaacgtgatccagcacaggtt
aagggccagccgcagtctcagttgttacatgaagtggtattttg
back to top
>AB289860.1-S-RNase.m1506
tattttcaatttgtgcaacaatggccaccgaccaactgcagagtccgcaataaaccttgctccaaaccccggccattaca
aatcttcaccatccatggcctatggccaagtaatcattcaaacccaacgatgcccagtaattgcaatgggacgcaattta
agcgaatattgtcccctgatttgcgatccgatctgacgagatcttggccggacgtggaaagtggtgatgatacaaaattt
tgggaaggcgaatggaacaagcatggtaaatgttccgaacagacacttaatcaaatgcagtacttccagcgatcccacga
aatgtggtacgcgttcaatattacaaagatccttaaaaacgcttcaatcgtaccacatgctacacaaacatggacctact
ccgacatagtagcacccattaaaacagcaactaagagaacacccctccttcgttgcaaatacgataagaagactcagttg
ttactcttacatgaagtggtattttg
back to top
>AB289859.1-S-RNase.m1506
tattttcaatttgtgcaacaatggccagtgaccaactgtagagttcgcatcaagaaaccttgctccaacccccggccatt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacggagcccagtaattgcaatgggacgaaat
ttgacgacaggaaagtgtaccctcatatgcgatccaaactgaggatatcttggcccgacgtggaaagcggcaatgataca
aatttttgggaacgcgaatggaacaagcatggtacgtgttccgaacggacacttaaccaattccaatacttcgagcgatc
ctacgaaatgtggagatcgcacaacattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
cgtactcggacatagtatcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaatacgataaaaacact
cagttgttacatgaagtggtattttg
back to top
>AB289858.1-S-RNase.m1512
tattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaacccccggccgtt
acaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaaatgcactgggtcgaaat
ttaactttacgaaagtgttcccttatttgcgatccaacctgaagaaatcttggccggacgtggaaagtggaaatgataca
aaattttgggaaggcgaatggaacaaacatggtacatgttcctcacggatacttaaccaaatgcaatacttccaacggtc
ccacgcaatgtggaaatcacacaatattacagagatcctaaaaaacgcttcaatcgtaccaagtgcgacacagacatgga
cctactccgacatagtagcacccattaaaacagcaaccaagagaacacccgtccttcgttgcaaaagtgatccagcaact
aataccgagttgttacatgaagtggtattttg
back to top