S-RNase, S-RNase (gene) Prunus webbii

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus webbii
Synonym S-RNase
ribonuclease
Description self-incompatibility
self-compatibility
Comment PwSf
PwS6
PwS5
PwS4
PwS3
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseDQ993666.1-S-RNasePrunus webbiigene
S-RNaseDQ993665.1-S-RNasePrunus webbiigene
S-RNaseDQ993664.1-S-RNasePrunus webbiigene
S-RNaseDQ993663.1-S-RNasePrunus webbiigene
S-RNaseDQ993662.1-S-RNasePrunus webbiigene
S-RNaseAM690360.1-S-RNasePrunus webbiigene
S-RNaseAM690359.1-S-RNasePrunus webbiigene
S-RNaseAM690358.1-S-RNasePrunus webbiigene
S-RNaseAM690354.1-S-RNasePrunus webbiigene
S-RNaseAM690353.1-S-RNasePrunus webbiigene
S-RNaseAM690352.1-S-RNasePrunus webbiigene
S-RNaseAM690364.1-S-RNasePrunus webbiigene
S-RNaseAM690363.1-S-RNasePrunus webbiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseDQ993666.1-S-RNase.m1Prunus webbiimRNA
S-RNaseDQ993665.1-S-RNase.m1Prunus webbiimRNA
S-RNaseDQ993664.1-S-RNase.m1Prunus webbiimRNA
S-RNaseDQ993663.1-S-RNase.m1Prunus webbiimRNA
S-RNaseDQ993662.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690360.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690359.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690358.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690354.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690353.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690352.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690364.1-S-RNase.m1Prunus webbiimRNA
S-RNaseAM690363.1-S-RNase.m1Prunus webbiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus webbiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ993666.1-S-RNase N/A DQ993666.1
gene parsed from NCBI nr database DQ993665.1-S-RNase N/A DQ993665.1
gene parsed from NCBI nr database DQ993664.1-S-RNase N/A DQ993664.1
gene parsed from NCBI nr database DQ993663.1-S-RNase N/A DQ993663.1
gene parsed from NCBI nr database DQ993662.1-S-RNase N/A DQ993662.1
gene parsed from NCBI nr database AM690360.1-S-RNase N/A AM690360.1
gene parsed from NCBI nr database AM690359.1-S-RNase N/A AM690359.1
gene parsed from NCBI nr database AM690358.1-S-RNase N/A AM690358.1
gene parsed from NCBI nr database AM690354.1-S-RNase N/A AM690354.1
gene parsed from NCBI nr database AM690353.1-S-RNase N/A AM690353.1
gene parsed from NCBI nr database AM690352.1-S-RNase N/A AM690352.1
gene parsed from NCBI nr database AM690364.1-S-RNase N/A AM690364.1
gene parsed from NCBI nr database AM690363.1-S-RNase N/A AM690363.1
mRNA parsed from NCBI nr database DQ993666.1-S-RNase.m1 N/A DQ993666.1
mRNA parsed from NCBI nr database DQ993665.1-S-RNase.m1 N/A DQ993665.1
mRNA parsed from NCBI nr database DQ993664.1-S-RNase.m1 N/A DQ993664.1
mRNA parsed from NCBI nr database DQ993663.1-S-RNase.m1 N/A DQ993663.1
mRNA parsed from NCBI nr database DQ993662.1-S-RNase.m1 N/A DQ993662.1
mRNA parsed from NCBI nr database AM690360.1-S-RNase.m1 N/A AM690360.1
mRNA parsed from NCBI nr database AM690359.1-S-RNase.m1 N/A AM690359.1
mRNA parsed from NCBI nr database AM690358.1-S-RNase.m1 N/A AM690358.1
mRNA parsed from NCBI nr database AM690354.1-S-RNase.m1 N/A AM690354.1
mRNA parsed from NCBI nr database AM690353.1-S-RNase.m1 N/A AM690353.1
mRNA parsed from NCBI nr database AM690352.1-S-RNase.m1 N/A AM690352.1
mRNA parsed from NCBI nr database AM690364.1-S-RNase.m1 N/A AM690364.1
mRNA parsed from NCBI nr database AM690363.1-S-RNase.m1 N/A AM690363.1

Sequence(s):
>DQ993666.1-S-RNase1205
gtgcaacaatggccaccgaccacctgcagatttagcggcaaaccttccaacaaccgccgtccattaccaattttcaccat
ccatggcatatggccaagtaattattcaaacccaaggatgcgcagtaattgcactgggtcgcaatttaaaaaaatattgg
tatgtattgtgtttgtttttttttaacgtactatttggcatttagtttttaaaaaattagattgtcatctgaagacaatg
tacttctttttcaacaaacttgggtgttatctaggtgcaaattgtaagtacaattatattcttaggtatattaatgcaac
tagtcatgcatttatttcatgtgccctatctaatttgttgacatatgtcattccactaacttttaaacttaacactggta
acttttaatacaattagaaaaacaaaaattaattattaaagaaataacaaaaatccaacagccatcacaacaccccaccc
acccaattaacctggtcagccaccccaccccactggcggcaaagcccctctcttcccatatcctattagaagttagtggg
agtgacaggtgtcggggacagggagaggggcacaagaaaattggactatttacaatcatcttaaaggacctaccattttg
tactaataccgtacctaaataaatagtcaaaattataatttaatttaacgctcaggtttaatgaaaaaaacaatttattc
aagaatgaagatctatctatatcttaagtctgtactttttctcaaaatctttagttttcactctttctaaaaaaatgtct
aatatatcttggatgtctcagtcccctcggttgcgatccaaactggagagagcttggccagacgtggaaagtggcaatga
tacaaaattttgggaagacgagtggaacaaacatggcaaatgttccgaacagacacttaaccaaatgcaatacttcgagc
gatcccaccaaatgtggagctcgttcaatattacaaatatacttgaaaaggcttcaatcgtaccaaatgcgacacaaaca
tggacctactcggacatattatcacccattaaagcagcaactcaaagaatacccctccttcgttgcaaaggaaatccaca
gcgccaggcgaagtctcagcctaagaatcgggggaagtctcagcctaagagccaagcgacgactcagttgttacatgaag
tggta
back to top
>DQ993665.1-S-RNase838
gtgcaacaatggccaccgaccaactgcagatttcgcatcaagcgaccttgctccaaaccccggccattacaatatttcac
aatccatggcctatggccaagtaattattcaaacccaaggattcccagtaactgcactgggtcgcaatttaagaaacaga
atttggtatgtatttttttttttcacttagtttttagaaacttagattgtcgtctgaaaataatataaacttttaataaa
ttttgggtgttacataaagctttatgcctcttaagtataaagttggaagtacatttatataagcattttataataatata
tcatttaataaatggatttaccatgttgtactagcaaatataatcaaaattcaatttaggacagatttaatgaagaaaaa
agaagaagttcttatccaataatgaaaatctaactatccctttgcgttcttacttttaactcgaaatatttatatattgc
ttggatgcctcagtacccttatttgcaatccgtactgaagaaatcttggccggacgtggaaagtggcaatgatacaaaat
tttgggaaggcgaatggaacaaacatggtacatgttccgaacggacacttaacataatgcagtacttccagcgatcctac
gcaatgtggaaatcacacaatattacagagatccttcaaaacgcttcaatcgtaccacatccgacacaaacatggaagta
ctcggacatagaatcaccaattaaaacagcaactaaaagaacacctgtccttcgttgcaaacctgatccagcacagaata
agagcgggccaaagactcagttgttacatgaagtggta
back to top
>DQ993664.1-S-RNase584
gtgcaacaatggccaccgaccaactgcagagttcgcatcaagaaaccttgctccaacccccgcccattacaatatttcac
catccatggcctatggccaggtaattattcaaacccaacgaagcccagtaattgcaatgggacgaaatttgacgacagga
aagtggtatgtaatttttcttttttcacttactctttagcatttaggttttagaaaattagattgtcgtctgaagacaat
atattgcttggatgtctcagtatcctcatatgcgatccaaactgaagatatcttggcccgacgtggaaagtggcaatgat
acaaatttttgggaacgcgaatggaacaagcatggtacgtgttccgaacggacactcaaccaattccaatacttcgagcg
atcctacgaaatgtggagatcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacat
ggacgtactcggacatagtatcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaatacgataagaac
actcagttgttacatgaagtggta
back to top
>DQ993663.1-S-RNase2101
gtgcaacaatggccaccgaccaactgcaaaatccgcacgaaatgctccaaaccccggcaattacaaatgttcaccatcca
tggcctgtggccaagtaattattcaaacccaacgctgcccagtaattgcaaagggtcgctttttgaggcaaggaaagtgg
tatgtactgtctaattagactgtatcatgtgaagatactttacttgttttaataaaccttggcattcagataaaattttg
atgttgtcctttggttagccatattatttttaatacaatatatatctaaatacaaaattgtaagatataaaatggtctac
cagtttgtacttatgtatatattcaaaatagtataatactcatatttaatcaagaaaaaacaatttcattcaataatgaa
aatctaactatccaattgacaaaggaaataaaaattgagtaatgctacacttaccacattattatcccacatttctatat
cacatgatatggcatatcgatatcatatgccacatcaattaaatgaatgaagtgtattttaataaataaaattagaaaaa
caaaaactagtattttacatgatgtggtatgtatacattagctgtcacatcatgtggtataaaattgtggtataaaaaat
atgataagactagtattattcataaaaatttagaaatacactaatgatgtcgtttgaagtcatttcttgacttcataaaa
atttccaaaattgatatacctaattcccttgtttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcattggcatcaccactaacccccactacaacatgtgt
tatcaccaccaccactctcctcccacattcttgctgccaccaccatcccaccattgtcaccacaccgccttcactatctc
cattaacacatctaacaatcactagattgcaataaaggtcaaattctgtgtttcatcattttgaatttcattagcttgaa
attacttaatacttctaaatgttattgtccaaaccgagggccaccgtttaatttttctcatatatatatatatatatatt
ttgcttcgatgcctcagtaccctcaattgcaaactaaactaaagagatcatggcccgacgtggaaagtggcaatgataca
aaattttgggaaggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagctttc
ccaccaaatgtggatgtcgcacaatattacagatatcctttataacgctcaaatcgtaccaaatgcgacaaaaacatgga
actactgggacatagtatcacccattaaagcggcaactaatgcaacaccactccttcgttgcaaactggttaagaagact
cagttgttacatgaagtggta
back to top
>DQ993662.1-S-RNase1798
gtgcaacaatggccaccgaccacctgcatacgtagcaggaaaccttgctccaaacacctgccattaccaatattcaccat
ccatggcttatggccaagcaattattcaaacccaacgatgcccagtaattgcattgggtcgctatttaacgaaagtaaat
tggtatgtatcgttccacttcttttttttttttcacttactctaattagcatttagtttttagaaaattagattgtcata
tgaagatagtatactttttattaaggaattttttaagaaatgtcatctgaacttatacctcaatttcaatttgtcacctt
aaagaaaaatttaagagaaatgtcaccttaatttttcaaaatccatgatttgttatcttattataacaccatccaatttt
tcatacatttttaagggtattttaaaaatggtaaaatcattataattttttattatttcttttaaacaattaaaattgaa
aaaaaaaaaattaccttcccctcccctgtgcgccactggtagctccaaccaaccccggtcaccttgaaatccatttcccc
ttccctctttacaaccccttcctccttctctatataccatgaaacacctaccctccacacataaatttcctcaacccacc
caaaccgagtccacctttttctttttcttttttctttttggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacccttaaaatggatggaaaccagaatg
gtgttaaagtcaaatgacatatcatgaattttgaaaaattaagatgacatttcttttaaatttttctttaaggtgacaaa
ttgaaactgaggtataagtctaggtgacatttctacaaaaatcccttttattaaagataaaatgttgatgtacattcata
aatatatctacgttccaacaaaaaaataaaatttatatatctacgtatataatttataatgatggatatgattatctaat
taaagaatctaccattttgtacttatgttttgaatataatgagagtatatattcaaaatattgtgcctcaaagaaaaaat
caaaataaaaacatattatcttaagaaaactcaagttatttgacgaaaaaaaatattttcatttttgaaaatcaaactat
cttacgtgtatattacatgtctcagtaccctaaattgcggtccaaactgaagatatcttggcccgacgtggaaagtggca
atgatacacaattttgggagggtgaatggaacaaacatggtagatgctccaaagagatgcttaaccaaatgcaatacttc
gagcgatcccacgcaatgtggaactcgcacaatattacaaatatcctagaaaacgctcaaatcgtaccaaatgcgacacg
aaaatggaagtactcggacatattaacacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacctgatc
cagcacagtctaactctcagttgttacatgaagtggta
back to top
>AM690360.1-S-RNase955
cttgttcttggttttgctttcttcttgtgtttcattatgagcactggtgggttgcattacaatctttttgctcgtcattt
caacctaaaactatgtactttatacaccaaatccttatttaagataccattaaccttctcrcaataatttgcgcaggatc
ttacgtgtattttcaatttgtgcaacaatggccaccgacgacctgcagacttagcagcaaaccttccaaccaacaccggc
cattacaaagattcaccatccatggcttatggccaagtaactattcaaaccccaggaagcccagtaattgcaatggttcg
cgatttaacaaagtggtacgtattgtgtttttttaacttactctttagcacttagttctaaaaaattagattatcatgtg
atrataatatactttcttggtagataaaattgtaatgttggttttctggttaggaacattattttgcatatatgtaccta
agtataaaattggaagtaaattgaaagcataaaaataaaaattcaatttaatactcccattttatccgataatgaaaatc
tatccctaatgtatttccttttttttttttttctttctaaaaatatgttacatatggcttggatgtctcagtaccctcaa
ttgcgaaacaaactgaagatatcttggcccgacgtggaaggtggcaatgatacaaaattttgggaaggtgaatggaacaa
acatggcacatgttccgaagagagacttaaccaaatgcaatacttcgaacgatcccacaacatgtggatgtcgtacaata
ttacagagatccttaaaaacgcttcaatcgtaccgcatccgacacaaacatggaagtactcggacatagtatcacccatt
aaaacagcaactggaagaacacccctccttcgttgcaaatacgataaaagcactcagttgttacatgaagtggta
back to top
>AM690359.1-S-RNase936
ggatcttatgtgtatcttcaatttgtgcaacaatggccaccgacgacctgcagacttagcagcaaaccttccaaccaaca
ccggccattacaaagattcaccatccatggtctatggccaagtaactattcaaacccaaggaagcccagtaattgcaaag
ggtcgcaatttaactttacgaaagtggtatgtattgtttttcttttttcacttactctttagcattcaggatttagaaaa
ctagattgtcatctgaagataatacactttcttggtagataaaattgtaatgttgggattctggttaggaacattatttt
gcatatatacctaagtataaaattgtaagtaattttatattcgtaggtatatgaatttacttaagcatatatttataata
atggatctgataatctaattgaagaacctcccattttgtacttgcctatatattcaaaatattgtacctgattgaaaggt
taaaaataaaaattcaatttaatgaagaaaaaaattaattttatcggataatgaaaatctaactatccctaatgtatatt
ttttttgttataaaattatgtatatatggcgtggatgtttcagtaccctcaattgcgaaacaaactgaagagatcttggc
ccgacgtggaaggtggcaatgatacaaaattttgggaaggtgaatggaacaaacatggcacatgttcggaagagagactt
aaccaaatgcaatacttcgagcgatctcatgacatgtggttgtcgtacgatattacaaatatccttaaaaacgcttcaat
cgtaccgagcgcgacaaaaacatggaagtactcggacatagtttcaccaattaaatcagcaactaatagaacagccctcc
tccgttgtaaacgtgatccagcgacgccgaagtctcagctgttacatgaagtggta
back to top
>AM690358.1-S-RNase1205
gtgcaacaatggccaccgaccacctgcagatttagcggcaaaccttccaacaaccgccgtccattaccaattttcaccat
ccgtggcatatggccaagtaattattcaaacccaaggatgcgcagtaattgcactgggtcgcaatttaaaaaaatattgg
tatgtattgtgtttgtttttttttaacgtactatttggcatttagtttttaaaaaattagattgtcatctgaagacaatg
tacttctttttcaacaaacttgggtgttatctaggtgcaaattgtaagtacaattatattcttaggtatattaatgcaac
tagtcatgcatttatttcatgtgccctatctaatttgttgacatatgtcattccactaacttttaaacttaacactggta
acttttaatacaattagaaaaacaaaaattaattattaaagaaataacaaaaatccaacagccatcacaacaccccaccc
acccaattaacctggtcagccaccccaccccactggcggcaaagcccctctcttcccatatcctattagaagttagtggg
agtgacaggtgtcggggacagggagaggggcacaagaaaattggactatttacaatcatcttaaaggacctaccattttg
tactaataccgtacctaaataaatagtcaaaattataatttaatttaacgctcaggtttaatgaaaaaaacaatttattc
aagaatgaagatctatctatatcttaagtctgtactttttctcaaaatctttagttttcactctttctaaaaaaatgtct
aatatatcttggatgtctcagtcccctcggttgcgatccaaactggagagagcttggccagacgtggaaagtggcaatga
tacaaaattttgggaagacgagtggaacaaacatggcaaatgttccgaacagacacttaaccaaatgcaatacttcgagc
gatcccaccaaatgtggagctcgttcaatattacaaatatacttgaaaaggcttcaatcgtaccaaatgcgacacaaaca
tggacctactcggacatattatcacccattaaagcagcaactcaaagaatacccctccttcgttgcaaaggaaatccaca
gcgccaggcgaagtctcagcctaagaatcgggggaagtctcagcctaagagccaagcgacgactcagttgttacatgaag
tggta
back to top
>AM690354.1-S-RNase1021
cttgttcttggtttcgctttcttcttgtgtttcattatgagcactggtgggttgcattacaatttttttcctctttatat
tctgtatgcatatagttagcattgcattttatacttctattttatgtttagatatatttgcatttatcaggtaagggagg
acttgatgatctagcgcacaactttctttggatgaataactatttgggaattacatttctgcatgatttctttggtttac
tctgatagttgttgcaatatataagtgcagtagtcagcttttcaagctaaaactatgtacttttatctacatcaaatcct
tatttaagataccgttaaccttctcacaatttcgcaggatcttatgtgtattttcaatttgtgcaacaatggccaccgac
gacctgcagacttagcaacaaaccttccaaccaacaccggccattacaaagattcaccatccatggcctatggccaagta
actattcaaacccaaggaagcccagtaattgcaatgggtcgcaatttaaaagattggtatgtgttgtttcatattttgtt
tcgcgtatatattcaaaatattatacctaatgaaaggactaaaataatcagtttaatatactcaggttttatgaagaaaa
aaatatcttaaaatttaacaatccctaaagtttttacttgtttttttctcggaaaatgtctatattgcttggatgtctca
gccccctcaattgatatccaaactgaagatatcttggcccaacgtggaaagtagcaatgatacaaaattttgggaaggcg
aatggaacaaacatggtacatgttccgaacagacaattaaccaattgcaatacttcgagcgatgctatgaaatgtggaag
tcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccaacacaaacatggacctactccgacatagt
agcacccattaaagcagcaactaaaagaacacccgtccttcgttgcaaacctgatccagca
back to top
>AM690353.1-S-RNase1080
tttcagtttgtgcaacaatggccaccgacaaactgcagagttcgcatcaagcgaccttgctccaatccccggccactaca
atatttcaccatccatggcctatggccaagtaactattcaaacccaacgaagcccagtaattgcaatgggtcgcaattta
actttacgaaagtggtatgtattatttcaaattttttttttttcacttactctttagcttttattgtttttattttttgc
acaaatactctttagcattttagtttttagaaaattagattgtcgtatgaagatttaaaatttaattaaaattttttttt
caataagccttgggggttagatataaaattttggtgttggtttagtttttttaattattatttttttaatgttggttctt
agttagacacattattttgaaaatatagtcaagttcaaaatggtacgtatatttatatttatatgcatattaatgtactt
gcgaaaatatgatggatctgctcatctaattacatgacctaccattttgtcctaatgtatatatgcaaaaaatttgttag
aagaaaaagcaaggctataatatattattgaaggttgaactcaaaattcaatttaatgctcagatttaaagaaacaaaaa
aaaaaaaaaatcttattcaagaatgaaaatctaattatcatttattcaatttactttttctgaaaatatgtgtctatatt
gcttggatgtctcagtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaatgatacaag
gttttgggaaggcgaatggaacaaacatggtacatgttcggaaggttcacttaaccaaatgcaatacttcgagcgatccc
acgaaatgtggtactcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaag
tactcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatccagcacagaa
taagagcgggccgaagactcaattgttacatgaagtggta
back to top
>AM690352.1-S-RNase2010
cttgttcttggtttcgctttcttcctgtgtttcattatgagcactggtgggttgcattacaatcttttgctgttaaatat
gcatataatttgcattgattttgtgttcgatgatatatataatgtagcggaggactttgatctagctcacaactttcttt
ggctgagtttactcgggcattacttttctgcatgctttatttcgtttactgtgatagttgttgcaataagtgcagcggga
attatgttctttatgcatcaaattcttatttaagataccattaaccttctcacaataattttcgcaggatcttatgtcta
ttttcaatttgtgcaacagtggccaccgactaactgcagagttcgcaataagccttgctccaaaccccggccattacaaa
tcttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggccgcaatttaag
cctatattggtatgcattgtttcgcttactctttagcttttagttttatttttacaaaattagattgtcatatgaatcta
atatactcttttatagaccttggacgtcagatgaaattttgatgctgatgtcctcttgttaagtattgtttggtgcgtgt
gtatatatagttgaggaatcccttaaataagttaatttgagggacatttttgtagagccaaccacacattgtattaaatg
tgatatgaactttctagttgttagatatttccctcaaagatcatctctgaaaaaaaatcgcttgaatccgaaatgatttg
accactaaattagatggttgttattacattattttcttgaatcatcgtgttggtccaagctagatgccttaatgattttc
aatttgcctaagtttttgcaaggattgtttatgaataaagacttgaaaaataaatgatttagatagttgataattttttt
tttttataggggaccctatatcttaaggagtacattggtatattaatgtacctacttatacatttatactaatatatcta
attatctaattaaaggatctaccattttatacttacgtatatatttaaaatattatagataatatctctcaccaaaaaat
tattatagctaatgaaaggactagaatccaatttaaacctcaggtttaatgaaagaaataatttaattcaataatgaaaa
tgtaagagtaagagcatctctaagagtagtagcaaattaaattctttaaattaaagtttgttgacctatgtggccatttg
aaaatgtttatttgttacttgaataatttttgctacaacagtctcttcaattaatgcaatatcatggaagaatgaaaaat
atgaaaacatgtgaaaaatgtctatgtatttattatttgaaaagaaaaaatgcatgtttttaatattttcaatgtagatt
ttgtttttacaaagtaaaattaaattatttgaagagcgaaagttaatttattagtcatgaagagagagaaagagattgca
actttgatgactatgtttgacaaggatgttagagagattttttatgatgtggcttacctatttaaacattccaaagtagt
tgaagagactattagagatgctctaactatctattccttaaaaatgtttgtttttctcaaaatatgttggttggtcccag
tcccctcgattgcgttccaaactgaagatatcttggcccgacgtggaaagtggcaatgatacaaagttttgggaagcgga
atggaacaaacatggtacatgttccgaacagacactaaaccaattccaatacttcgaccgatcctacgcaatgtggagat
cgtacaatattacagaaatccttaaaaacgctacaatcgttccaagtccgacacaaacatggaagtattcggacatagta
tcacccattaaaacagcaactaaaagaacacccctcttacgttgcagaaaggatccagcacagaattctcagttgttaca
tgaagtggta
back to top
>AM690364.1-S-RNase936
ggatcttatgtgtatcttcaatttgtgcaacaatggccaccgacgacctgcagacttagcagcaaaccttccaaccaaca
ccggccattacaaagattcaccatccatggtctatggccaagtaactattcaaacccaaggaagcccagtaattgcaaag
ggtcgcaatttaactttacgaaagtggtatgtattgtttttcttttttcacttactctttagcattcaggatttagaaaa
ctagattgtcatctgaagataatacactttcttggtagataaaattgtaatgttgggattctggttaggaacattatttt
gcatatatacctaagtataaaattgtaagtaattttatattcgtaggtatatgaatttacttaagcatatatttataata
atggatctgataatctaattgaagaacctcccattttgtacttgcctatatattcaaaatattgtacctgattgaaaggt
taaaaataaaaattcaatttaatgaagaaaaaaattaattttatcggataatgaaaatctaactatccctaatgtatatt
ttttttgttataaaattatgtatatatggcgtggatgtttcagtaccctcaattgcgaaacaaactgaagagatcttggc
ccgacgtggaaggtggcaatgatacaaaattttgggaaggtgaatggaacaaacatggcacatgttcggaagagagactt
aaccaaatgcaatacttcgagcgatctcatgacatgtggttgtcgtacgatattacaaatatccttaaaaacgcttcaat
cgtaccgagcgcgacaaaaacatggaagtactcggacatagtttcaccaattaaatcagcaactaatagaacagccctcc
tccgttgtaaacgtgatccagcgacgccgaagtctcagctgttacatgaagtggta
back to top
>AM690363.1-S-RNase1021
cttgttcttggtttcgctttcttcttgtgtttcattatgagcactggtgggttgcattacaatttttttcctctttatat
tctgtatgcatatagttagcattgcattttatacttctattttatgtttagatatatttgcatttatcaggtaagggagg
acttgatgatctagcgcacaactttctttggatgaataactatttgggaattacatttctgcatgatttctttggtttac
tctgatagttgttgcaatatataagtgcagtagtcagcttttcaagctaaaactatgtacttttatctacatcaaatcct
tatttaagataccgttaaccttctcacaatttcgcaggatcttatgtgtattttcaatttgtgcaacaatggccaccgac
gacctgcagacttagcaacaaaccttccaaccaacaccggccattacaaagattcaccatccatggcctatggccaagta
actattcaaacccaaggaagcccagtaattgcaatgggtcgcaatttaaaagattggtatgtgttgtttcatattttgtt
tcgcgtatatattcaaaatattatacctaatgaaaggactaaaataatcagtttaatatactcaggttttatgaagaaaa
aaatatcttaaaatttaacaatccctaaagtttttacttgtttttttctcggaaaatgtctatattgcttggatgtctca
gccccctcaattgatatccaaactgaagatatcttggcccaacgtggaaagtagcaatgatacaaaattttgggaaggcg
aatggaacaaacatggtacatgttccgaacagacaattaaccaattgcaatacttcgagcgatgctatgaaatgtggaag
tcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccaacacaaacatggacctactccgacatagt
agcacccattaaagcagcaactaaaagaacacccgtccttcgttgcaaacctgatccagca
back to top
>DQ993666.1-S-RNase.m1543
gtgcaacaatggccaccgaccacctgcagatttagcggcaaaccttccaacaaccgccgtccattaccaattttcaccat
ccatggcatatggccaagtaattattcaaacccaaggatgcgcagtaattgcactgggtcgcaatttaaaaaaatattgt
cccctcggttgcgatccaaactggagagagcttggccagacgtggaaagtggcaatgatacaaaattttgggaagacgag
tggaacaaacatggcaaatgttccgaacagacacttaaccaaatgcaatacttcgagcgatcccaccaaatgtggagctc
gttcaatattacaaatatacttgaaaaggcttcaatcgtaccaaatgcgacacaaacatggacctactcggacatattat
cacccattaaagcagcaactcaaagaatacccctccttcgttgcaaaggaaatccacagcgccaggcgaagtctcagcct
aagaatcgggggaagtctcagcctaagagccaagcgacgactcagttgttacatgaagtggta
back to top
>DQ993665.1-S-RNase.m1510
gtgcaacaatggccaccgaccaactgcagatttcgcatcaagcgaccttgctccaaaccccggccattacaatatttcac
aatccatggcctatggccaagtaattattcaaacccaaggattcccagtaactgcactgggtcgcaatttaagaaacaga
atttgtacccttatttgcaatccgtactgaagaaatcttggccggacgtggaaagtggcaatgatacaaaattttgggaa
ggcgaatggaacaaacatggtacatgttccgaacggacacttaacataatgcagtacttccagcgatcctacgcaatgtg
gaaatcacacaatattacagagatccttcaaaacgcttcaatcgtaccacatccgacacaaacatggaagtactcggaca
tagaatcaccaattaaaacagcaactaaaagaacacctgtccttcgttgcaaacctgatccagcacagaataagagcggg
ccaaagactcagttgttacatgaagtggta
back to top
>DQ993664.1-S-RNase.m1489
gtgcaacaatggccaccgaccaactgcagagttcgcatcaagaaaccttgctccaacccccgcccattacaatatttcac
catccatggcctatggccaggtaattattcaaacccaacgaagcccagtaattgcaatgggacgaaatttgacgacagga
aagtgtatcctcatatgcgatccaaactgaagatatcttggcccgacgtggaaagtggcaatgatacaaatttttgggaa
cgcgaatggaacaagcatggtacgtgttccgaacggacactcaaccaattccaatacttcgagcgatcctacgaaatgtg
gagatcgcacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacgtactcggaca
tagtatcacccattaaagcagcaactaaaagaacacccctccttcgttgcaaatacgataagaacactcagttgttacat
gaagtggta
back to top
>DQ993663.1-S-RNase.m1483
gtgcaacaatggccaccgaccaactgcaaaatccgcacgaaatgctccaaaccccggcaattacaaatgttcaccatcca
tggcctgtggccaagtaattattcaaacccaacgctgcccagtaattgcaaagggtcgctttttgaggcaaggaaagtgt
accctcaattgcaaactaaactaaagagatcatggcccgacgtggaaagtggcaatgatacaaaattttgggaaggcgaa
tggaacaaacatggtagatgttccgaacagacacttaaccaaatgcaatacttcgagctttcccaccaaatgtggatgtc
gcacaatattacagatatcctttataacgctcaaatcgtaccaaatgcgacaaaaacatggaactactgggacatagtat
cacccattaaagcggcaactaatgcaacaccactccttcgttgcaaactggttaagaagactcagttgttacatgaagtg
gta
back to top
>DQ993662.1-S-RNase.m1495
gtgcaacaatggccaccgaccacctgcatacgtagcaggaaaccttgctccaaacacctgccattaccaatattcaccat
ccatggcttatggccaagcaattattcaaacccaacgatgcccagtaattgcattgggtcgctatttaacgaaagtaaat
tgtaccctaaattgcggtccaaactgaagatatcttggcccgacgtggaaagtggcaatgatacacaattttgggagggt
gaatggaacaaacatggtagatgctccaaagagatgcttaaccaaatgcaatacttcgagcgatcccacgcaatgtggaa
ctcgcacaatattacaaatatcctagaaaacgctcaaatcgtaccaaatgcgacacgaaaatggaagtactcggacatat
taacacccattaaagcagcaactaaaagaacacccctccttcgttgcaaacctgatccagcacagtctaactctcagttg
ttacatgaagtggta
back to top
>AM690360.1-S-RNase.m1549
cttgttcttggttttgctttcttcttgtgtttcattatgagcactggatcttacgtgtattttcaatttgtgcaacaatg
gccaccgacgacctgcagacttagcagcaaaccttccaaccaacaccggccattacaaagattcaccatccatggcttat
ggccaagtaactattcaaaccccaggaagcccagtaattgcaatggttcgcgatttaacaaagtgtaccctcaattgcga
aacaaactgaagatatcttggcccgacgtggaaggtggcaatgatacaaaattttgggaaggtgaatggaacaaacatgg
cacatgttccgaagagagacttaaccaaatgcaatacttcgaacgatcccacaacatgtggatgtcgtacaatattacag
agatccttaaaaacgcttcaatcgtaccgcatccgacacaaacatggaagtactcggacatagtatcacccattaaaaca
gcaactggaagaacacccctccttcgttgcaaatacgataaaagcactcagttgttacatgaagtggta
back to top
>AM690359.1-S-RNase.m1519
ggatcttatgtgtatcttcaatttgtgcaacaatggccaccgacgacctgcagacttagcagcaaaccttccaaccaaca
ccggccattacaaagattcaccatccatggtctatggccaagtaactattcaaacccaaggaagcccagtaattgcaaag
ggtcgcaatttaactttacgaaagtgtaccctcaattgcgaaacaaactgaagagatcttggcccgacgtggaaggtggc
aatgatacaaaattttgggaaggtgaatggaacaaacatggcacatgttcggaagagagacttaaccaaatgcaatactt
cgagcgatctcatgacatgtggttgtcgtacgatattacaaatatccttaaaaacgcttcaatcgtaccgagcgcgacaa
aaacatggaagtactcggacatagtttcaccaattaaatcagcaactaatagaacagccctcctccgttgtaaacgtgat
ccagcgacgccgaagtctcagctgttacatgaagtggta
back to top
>AM690358.1-S-RNase.m1543
gtgcaacaatggccaccgaccacctgcagatttagcggcaaaccttccaacaaccgccgtccattaccaattttcaccat
ccgtggcatatggccaagtaattattcaaacccaaggatgcgcagtaattgcactgggtcgcaatttaaaaaaatattgt
cccctcggttgcgatccaaactggagagagcttggccagacgtggaaagtggcaatgatacaaaattttgggaagacgag
tggaacaaacatggcaaatgttccgaacagacacttaaccaaatgcaatacttcgagcgatcccaccaaatgtggagctc
gttcaatattacaaatatacttgaaaaggcttcaatcgtaccaaatgcgacacaaacatggacctactcggacatattat
cacccattaaagcagcaactcaaagaatacccctccttcgttgcaaaggaaatccacagcgccaggcgaagtctcagcct
aagaatcgggggaagtctcagcctaagagccaagcgacgactcagttgttacatgaagtggta
back to top
>AM690354.1-S-RNase.m1525
cttgttcttggtttcgctttcttcttgtgtttcattatgagcactggatcttatgtgtattttcaatttgtgcaacaatg
gccaccgacgacctgcagacttagcaacaaaccttccaaccaacaccggccattacaaagattcaccatccatggcctat
ggccaagtaactattcaaacccaaggaagcccagtaattgcaatgggtcgcaatttaaaagattgccccctcaattgata
tccaaactgaagatatcttggcccaacgtggaaagtagcaatgatacaaaattttgggaaggcgaatggaacaaacatgg
tacatgttccgaacagacaattaaccaattgcaatacttcgagcgatgctatgaaatgtggaagtcgcacaatattacag
agatccttaaaaacgcttcaatcgtaccacatccaacacaaacatggacctactccgacatagtagcacccattaaagca
gcaactaaaagaacacccgtccttcgttgcaaacctgatccagca
back to top
>AM690353.1-S-RNase.m1519
tttcagtttgtgcaacaatggccaccgacaaactgcagagttcgcatcaagcgaccttgctccaatccccggccactaca
atatttcaccatccatggcctatggccaagtaactattcaaacccaacgaagcccagtaattgcaatgggtcgcaattta
actttacgaaagtgtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaatgatacaagg
ttttgggaaggcgaatggaacaaacatggtacatgttcggaaggttcacttaaccaaatgcaatacttcgagcgatccca
cgaaatgtggtactcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggaagt
actcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatccagcacagaat
aagagcgggccgaagactcaattgttacatgaagtggta
back to top
>AM690352.1-S-RNase.m1558
cttgttcttggtttcgctttcttcctgtgtttcattatgagcactggatcttatgtctattttcaatttgtgcaacagtg
gccaccgactaactgcagagttcgcaataagccttgctccaaaccccggccattacaaatcttcaccatccatggcctat
ggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggccgcaatttaagcctatattgtcccctcgattg
cgttccaaactgaagatatcttggcccgacgtggaaagtggcaatgatacaaagttttgggaagcggaatggaacaaaca
tggtacatgttccgaacagacactaaaccaattccaatacttcgaccgatcctacgcaatgtggagatcgtacaatatta
cagaaatccttaaaaacgctacaatcgttccaagtccgacacaaacatggaagtattcggacatagtatcacccattaaa
acagcaactaaaagaacacccctcttacgttgcagaaaggatccagcacagaattctcagttgttacatgaagtggta
back to top
>AM690364.1-S-RNase.m1519
ggatcttatgtgtatcttcaatttgtgcaacaatggccaccgacgacctgcagacttagcagcaaaccttccaaccaaca
ccggccattacaaagattcaccatccatggtctatggccaagtaactattcaaacccaaggaagcccagtaattgcaaag
ggtcgcaatttaactttacgaaagtgtaccctcaattgcgaaacaaactgaagagatcttggcccgacgtggaaggtggc
aatgatacaaaattttgggaaggtgaatggaacaaacatggcacatgttcggaagagagacttaaccaaatgcaatactt
cgagcgatctcatgacatgtggttgtcgtacgatattacaaatatccttaaaaacgcttcaatcgtaccgagcgcgacaa
aaacatggaagtactcggacatagtttcaccaattaaatcagcaactaatagaacagccctcctccgttgtaaacgtgat
ccagcgacgccgaagtctcagctgttacatgaagtggta
back to top
>AM690363.1-S-RNase.m1525
cttgttcttggtttcgctttcttcttgtgtttcattatgagcactggatcttatgtgtattttcaatttgtgcaacaatg
gccaccgacgacctgcagacttagcaacaaaccttccaaccaacaccggccattacaaagattcaccatccatggcctat
ggccaagtaactattcaaacccaaggaagcccagtaattgcaatgggtcgcaatttaaaagattgccccctcaattgata
tccaaactgaagatatcttggcccaacgtggaaagtagcaatgatacaaaattttgggaaggcgaatggaacaaacatgg
tacatgttccgaacagacaattaaccaattgcaatacttcgagcgatgctatgaaatgtggaagtcgcacaatattacag
agatccttaaaaacgcttcaatcgtaccacatccaacacaaacatggacctactccgacatagtagcacccattaaagca
gcaactaaaagaacacccgtccttcgttgcaaacctgatccagca
back to top