S-RNase, S-RNase (gene) Prunus x keredjensis

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Prunus x keredjensis
Synonym NA
Description NA
Comment ribonuclease S1; coding region not determined; contains second intron
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseHM003204.1-S-RNasePrunus x keredjensisgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus x keredjensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM003204.1-S-RNase N/A HM003204.1

Sequence(s):
>HM003204.1-S-RNase676
tcaccattcatggcctatggccaagwaattattcaaacccaaggatgcccagtaattgcagggggtcgctatttgagaca
aggaaattggtatgcattgtttcatttatttgttttttcacttactctttagtatttagttttcagaaaatgagattgtc
gtatgaagttgttttttttccccaataaatcttgggtattagataaaattttgatgtcggtctgttctgcaaattatttt
gataatatacctaactacaaaattgtaaatacatttatattagtaggctgtaggtgtacacatagatacattaatgtatc
aagtaaaatgaagcgattatgttttgaatatttttcttaaattagggaaatatatataatgattctgctcatctaattaa
aggacatgctttctggcataaaaaatataataaggataggctattttgtttatatcgagaatttacctatcctttaatac
tcaagtttaacgaaaaaagaagtcttataaaaaaattgaaagtctcactactccttaagtttgtacctcttctttttctc
aaaatatgtctacattgcggatgtcagtcccctgaattgcaatccaaactgaagagatcttggcccaacgtggaaaccga
caatgatacaaagctttgggaacacgaatggaacaa
back to top