S-RNase, S-RNase (gene) Pyrus ussuriensis

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Pyrus ussuriensis
Synonym S-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseFJ490411.1-S-RNasePyrus ussuriensisgene
S-RNaseDQ988687.1-S-RNasePyrus ussuriensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseFJ490411.1-S-RNase.m1Pyrus ussuriensismRNA
S-RNaseDQ988687.1-S-RNase.m1Pyrus ussuriensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus ussuriensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database FJ490411.1-S-RNase scaffold02094:47080..48080
FJ490411.1
gene parsed from NCBI nr database DQ988687.1-S-RNase N/A DQ988687.1
mRNA parsed from NCBI nr database FJ490411.1-S-RNase.m1 scaffold02094:47080..48080
FJ490411.1
mRNA parsed from NCBI nr database DQ988687.1-S-RNase.m1 N/A DQ988687.1

Sequence(s):
>FJ490411.1-S-RNase996
tttacgcagcaatatcagccggctgcctgcaattctaatcctactccttgtaaggatcctactgagaaattgtttacggt
tcacggtttgtggccttcaaactctaatggacctgacccagtgaactgcaagccgaaaaccaaggtgcctcaggcgcagc
agccggtaatttatctgaaaatttaactttccccctctaaacacattttttctagcctataacccatcatatcgtattta
tcgcaataaaacccaataatcagaatccaactaaacaacttaccaaattattttgtgtgtcatttttttatattttttaa
ttctctaatatgccctcatctaagccagtatggaaagctcttgtaatcacgttttaattgatgacatgcatccaatttgg
caaggttttgtagccaagaaatctagttcaaaatgtaggaattaatttggaaatatttttcatttcaacaataaatttcg
atttgaatatacctaattttagggtttaatttcaacaatatatattgtttaattttataaaaataacatagctactatga
aacttacctacggtttattttcttatgaaaataatgcacctatctttgaattttgacaaagttaatgtctctgttttttt
aatttttaacaaaactaatttacctacttctttttatagtattagtatacataatatgtagaacatatgttcgtatgtat
ttgatctaatttagttttggattggggaagttcacacaaaattaaatgtctgaaaaaatgtacaagagatatggtggcct
gattttatatataaacacaaattcatggacatcttttgttcaacatggcatcttattcaaattttaagttttacttataa
gtcatcatacatgtgggcttttgtctagaagttatcataaatttttttatgtatattttatttgtcagaaagatccatca
ctcaaaccccagttggaaattatttggccgaacgta
back to top
>DQ988687.1-S-RNase333
tttacgcagcaatatcagccggccgtatgcaactcgaatcctactccttgtaacgatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaaggctacacccctgaattctcagaaggtaa
tattcctctgcgcttgtgtatacatactttacaatactcaacatagattttcatgcacgcctgtgcaaatattacaatta
atttaaagtttaatcatgaatcgtttctcatatataattatattgtcagataggaaatatgacagcccaattggaaatta
tttggccgaacgt
back to top
>FJ490411.1-S-RNase.m1213
tttacgcagcaatatcagccggctgcctgcaattctaatcctactccttgtaaggatcctactgagaaattgtttacggt
tcacggtttgtggccttcaaactctaatggacctgacccagtgaactgcaagccgaaaaccaaggtgcctcaggcgcagc
agccgaaagatccatcactcaaaccccagttggaaattatttggccgaacgta
back to top
>DQ988687.1-S-RNase.m1200
tttacgcagcaatatcagccggccgtatgcaactcgaatcctactccttgtaacgatcctcctgacaagttgtttacggt
tcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaaggctacacccctgaattctcagaagatag
gaaatatgacagcccaattggaaattatttggccgaacgt
back to top