S-RNase, S-RNase (gene) Sorbus aucuparia

Gene Overview
Name S-RNase
Gene Symbol S-RNase
Type gene
Organism Sorbus aucuparia
Synonym self-incompatibility RNase
Description NA
Comment mRNA sequence found in AF504256
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseEF464322.1-S-RNaseSorbus aucupariagene
S-RNaseEF464321.1-S-RNaseSorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RNaseEF494768.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494767.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494766.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494765.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494764.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494763.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494762.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494761.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494760.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494759.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494758.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494757.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494756.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494755.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494754.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494753.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494752.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494751.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF494750.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF464322.1-S-RNase.m1Sorbus aucupariamRNA
S-RNaseEF464321.1-S-RNase.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EF464322.1-S-RNase N/A EF464322.1
gene parsed from NCBI nr database EF464321.1-S-RNase N/A EF464321.1
mRNA parsed from NCBI nr database EF494768.1-S-RNase.m1 N/A EF494768.1
mRNA parsed from NCBI nr database EF494767.1-S-RNase.m1 N/A EF494767.1
mRNA parsed from NCBI nr database EF494766.1-S-RNase.m1 N/A EF494766.1
mRNA parsed from NCBI nr database EF494765.1-S-RNase.m1 N/A EF494765.1
mRNA parsed from NCBI nr database EF494764.1-S-RNase.m1 N/A EF494764.1
mRNA parsed from NCBI nr database EF494763.1-S-RNase.m1 N/A EF494763.1
mRNA parsed from NCBI nr database EF494762.1-S-RNase.m1 N/A EF494762.1
mRNA parsed from NCBI nr database EF494761.1-S-RNase.m1 N/A EF494761.1
mRNA parsed from NCBI nr database EF494760.1-S-RNase.m1 N/A EF494760.1
mRNA parsed from NCBI nr database EF494759.1-S-RNase.m1 N/A EF494759.1
mRNA parsed from NCBI nr database EF494758.1-S-RNase.m1 N/A EF494758.1
mRNA parsed from NCBI nr database EF494757.1-S-RNase.m1 N/A EF494757.1
mRNA parsed from NCBI nr database EF494756.1-S-RNase.m1 N/A EF494756.1
mRNA parsed from NCBI nr database EF494755.1-S-RNase.m1 N/A EF494755.1
mRNA parsed from NCBI nr database EF494754.1-S-RNase.m1 N/A EF494754.1
mRNA parsed from NCBI nr database EF494753.1-S-RNase.m1 N/A EF494753.1
mRNA parsed from NCBI nr database EF494752.1-S-RNase.m1 N/A EF494752.1
mRNA parsed from NCBI nr database EF494751.1-S-RNase.m1 N/A EF494751.1
mRNA parsed from NCBI nr database EF494750.1-S-RNase.m1 N/A EF494750.1
mRNA parsed from NCBI nr database EF464322.1-S-RNase.m1 N/A EF464322.1
mRNA parsed from NCBI nr database EF464321.1-S-RNase.m1 N/A EF464321.1

Sequence(s):
>EF464322.1-S-RNase448
cggctgcctgcaactctaatcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaagagagcaaaaacactcgaaccccagttgga
aattatttggccgaacgtcctcgatcgaacaaatcatacaggattctggcgtagacagtggaaaaaacatggcacctgtg
ggtatcccacaatacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgagaaacaaaacgtctct
cgaatcctctcaaatgcaaagattgaaccagacgggcaaagcagaccgctggtggacattgaaaatgccatacgcaacgg
tacccacaataaaaaaccaaaattcaagtgccaaaagaataatggggt
back to top
>EF464321.1-S-RNase451
cagctgtctgcagatctaatcctactccttgtaaggatcctactgacaagttgtttacggttcacggtttgtggccttca
aacttgaatggacctcacccagaaaattgcacgaatgcaaccgtgaatgctcacaggataaaaaatatccaagcccagtt
gaaaattatttggccgaacgtactcgatcgaaccaatcatgtaggcttctggaataaacagtggataaagcatggcagct
gtgggaatcccccaataatgaacgacacgcattactttcaaacagtaatcaacatgtacataacccagaaacaaaacgtc
tctgaaatcctctcaagggcgaagattgaaccgttgggaatacaaaggccactggtgcatattgacaaggccatacggaa
tagtatcaacaataagaaaccaaaattcaagtgcaaaaagaatgctggggt
back to top
>EF494768.1-S-RNase.m1540
tgtaaagatcctcctgacaagttgtttacggttcacggtttgtggccttcaaacatgaatcgaagtgaattatttaattg
cagtagttcaaacgtgacttatgcgaagatacaaaatatccgaacccagttggaaatgatttggccgaacgtattcaatc
gaaaaaatcatttaggcttctggaatagagagtggaacaaacacggcgcctgtgggtatcccacaatacggaacgacttg
cattactttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtctctgatatcctctcaaaggccaagattga
accggatggaaatatcaggacacagaaggaaattgtagatgccataaggaaaggtatccatggtaaggaaccaaaactca
agtgccaaaagaatactcagatgactgaattggttgaggtcactctttgcagcgatggcaacttaacgcagttcatagat
tgcccccaccattttccaaatggatcacgatataactgccccaccaatcatattctgtat
back to top
>EF494767.1-S-RNase.m1453
cggctgtctgcaactctcaccctactccttgtaaggatcctcctgacaagttgtttacggttcacggattgtggccttca
aacgttaatggacctgacccagaaaactgcaaggtcaaacccacgccgtctcaaacgatagatacatcactcaaacccca
gttggaaattatttggccgaacgtattcaatcgagccgatcatgaaagcttctggcaaaaacagtgggacaaacatggca
cctgtgggtctcccacaataatagacaagaaccattactttcaaacagtgatcagaatgtacataaccgagaagcaaaac
gtctcttatatcctatccaaagccaacatcaatccggatggtagaggcaggacacggaaggatattgaaattgctatacg
caatagtaccaacgataaggaaccaaagctcaagtgccaaaaaaaaaaaaaaa
back to top
>EF494766.1-S-RNase.m1564
aatcctactccttgtaangatcctcccgagaaattgtttacggttcacggtttgtggccttcaaactctaatggacctga
cccagtaaactgcaagccaaaaaccaaggtgcctcaggcgcagcagccgatagatgcatcactcaaaccccagttgaaaa
ttatttggccgaacgtattcaatcgagccgataatgaaagcttctggaataaacagtgggacaaacatggcacctgtggg
tctcccacaataaaagacaagaaccattaccttcaaacagtaatcaaaatgtacataacccagaaacaaaacgtctctca
aatcctatccaaagccaatatcaatccagacggtatagcccggacacggaagctaattgaaagtgccatacgcaatggta
ctaacgataaggaaccaaaactcaagtgccaaaagtataatgggactattgaattggttgaggtcactctttgcagcaat
tacctcggaaaacatttcataaattgccccaacaaaattccagaaggatcacgatatttctgccccatcacagatatcca
gtat
back to top
>EF494765.1-S-RNase.m1563
cggctgtctgcaactttagtcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacgcgaagggaaatgacccagaaggttgtaagacacagaaatatcagaagatgcaaacactcgaaccccagttggaaat
tatttggccgaacgtgtacaatcgaaccgctaatgaagtcttctggcgtaaacagtggtataaacatggctcctgtgcgt
ctcccccattaaagaaccagacgcattactttgatacagtaatcaaaatgtacagaacccagaaacaaaacgtctcttac
atcctctcaagggcgaatattgaaccgaagggggaaaaaagggcactggtggacattgaaaatgccatacgcagtggtac
caacaataaggcaccaaaactcaagtgccaaacgaatgctaggatgactgcattggttgaggttactctttgcagcgata
gcaacttaacgcagttcataaattgcccccgcccatttccaccaggatcaccatttatctgccccaccgataatattcag
tat
back to top
>EF494764.1-S-RNase.m1558
gtctgcaactttactcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttcaaactc
gaagggaaaggacccagaaggttgcaagacaaagaaatatcagaagatgcaagtactcgaaccccagttggaaattattt
ggccgaacgtatacaatcgaaccgctaatgaagacttctggcgtaaacagtggtataaacatggctcctgtgcgtctccc
ccattacagaaccagacgcattactttgatacagtaatcaaaatgtacagaacccagaaacaaaacgtctcttacatcct
ctcaaaggcgaacattgaaccgaagggggaaaaaaggacacgggtggacattgaaaatgccatacgcagtggtaccaaca
atatggtaccaaaactcaagtgccaaacgaatggtaggattactgcattggttgaggtcactctttgcagcgatagcaac
ttaacgcagttcataaattgtccccgcccaattccaccaggatcaccatatttatgccccaccaataatattcagtat
back to top
>EF494763.1-S-RNase.m1552
tctaatcctactccttgtaacgatcctcctgacaagttgtttacggttcatggtttgtggccttcaaacaagaatggacc
tgacccagaaaaatgcaagaatatacaaatgaattctcggaagataggaaatatgacagcccagttggaaattatttggc
cgaacgtactcaatcgaaccgatcatgtaggcttctgggaaagagagtggctcaaacatggcacctgcgggtatcccaca
ataagggacgacatgcattacttgaaaacagtaatcaaaatgtacataacccagaaacaaaacgtctctgcaatcctctc
aaaggcgatgattcaaccgaacgggaaaaacaggtcattggtggatattgaaaatgccatacgcagtggtaccaacaata
tgaaaccaaaattcaagtgccaaaagaatactaggacgacgactgaattggttgaggtcactctttgcagtgatagagac
ttaacgaagttcataaattgccctcaacgatctcaaggatcacgatatctctgccccgccgatgttcagtat
back to top
>EF494762.1-S-RNase.m1573
tgcaactctaatcctactcgttgtaaggatcctcctgagaaattgtttacggttcacggtttgtggccttcaaactctaa
tggacctgacccagtaaactgcaagccgaaaaccaaggtgcctcaggtgccgcagccgatagatgcatcactcaaacccc
agttgaaaattatttggccgaacgtattcaatcgatccgatcatgaaagcttctggaataaacagtgggacaaacatggc
acctgtgggtctcccacaataaaagacaagaaccattactttcaaacagtaatcaaaatgtacataacccagaaacaaaa
cgtgtctcaaatcctatccaaggccaacatcaatccagacggtataggcaggacacggaagctaattgaaagtgccatac
gcaatggtaccaacgataaggaaccaaaactcaagtgccaaaagaataatgggattattgaattggttgaggtcactctt
tgcagcaattacctcggaaaacaattcataaattgccccaacaaaattccagaaggatcacgatatttctgccccatcaa
agatatccagtat
back to top
>EF494761.1-S-RNase.m1575
tctgcaactctaatcctactccttgtaaggatcctcctgagaaattgtttacggttcacggtttgtggccttcaaactct
aatggacctgacccagtaaactgcaagccgaaaaccaaggtgcctcaggcgccgcagccgatagatgcatcactcaaacc
ccagttggaaattatttggccgaacgtattcaatcgagccgataatgaaagcttctggaataaacagtgggacaaacatg
gcacctgtgggtctcccacaataaaagacaagaaccattactttcaaacagtaatcaaaatgtacataacccagaaacaa
aacgtctctcaaatcctatccaaagccaacatcaatccagacggtataagcaggacacggaagctaattgaaagtgccat
acgcaatggtaccaacgataaggaaccaaaactcaagtgccaaaagaataatgggactattgaattggttgaggtcactc
tttgcagcaattacctcggaaaacaattcataaattgccccaacaaaattccagaaggatcacgatatttctgccccatc
aaagatatccggtat
back to top
>EF494760.1-S-RNase.m1569
cggctgtctgccactttaatcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacagctcaggaaatgacccaatatactgcaagaatacaaccatcaattctactaagatagcaaatctgacagcccagtt
ggaaattatttggcccaacgtactcgatcgaaccgatcatataaccttctggaataaacagtggatcaaacatggcagct
gtgggcatcccgcaatacagaacgacatgcattacttgcaaacagtaatcaagatgtacataacccagaaacaaaacgtc
tctgaaatcctctcaaaggcgaagattgaaccggtggggagattctggacacagaaggaaattgaaagggccatacgcaa
aggtaccaacaataaggaaccaaaactcaagtgccaaaagaatactcaggggactaaattggttgaggtcactatttgta
gcgatcgcaacttaaagcagttcatagattgcccccgccctattttaaatggatcacgatactactgccccatcaataat
attctgtat
back to top
>EF494759.1-S-RNase.m1566
cagctgtctgcaaatctaatcctactccttgtaaggatcctactgacaagttgtttacggttcacggtttgtggccttca
aacttgaatggacctcacccagaaaattgcacgaaaacacccgtgaattctcataggataaaaaatatccaagcccagtt
ggaaattatttggccgaacgtactcgatcgaaccgatcatgtaggcttctggaataaagagtggaaaaaacatggcagct
gtgggaatcccacaataaagaacgacacgcattactttcaaacagtaatcaacatgtacataacccagaaacaaaacgtc
tctgaaatcctctcaaaggcgaagattgaaccgttgggaatacaaaggccactggcgcatattgaaaaggccatacggaa
tagtatcaacaagaagaaaccaaaattcaagtgccaaaataatggtggggtgactgaattggttgagatcagtctttgca
gcgatcgcagcttaacgcagttcagagattgcccccacccatttccactaggatcaccatatctctgccccaccgatatt
cagtat
back to top
>EF494758.1-S-RNase.m1566
tggctgtctgcaactccagtcgtactcgttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
agcatggtaggacctgacccaagtaattgcccgataaagaatattcggaagagagaaaaattactcgaaccccagctgga
aattatttggccgaacgtattcgatcgaaccaaaaataaactcttctgggataaagagtggatgaaacatggctcctgtg
ggtatcccacaatagataacgagaaccattactttgaaaccgtaatcaaaatgtacatcaccaggaaacaaaacgtctct
ggaatcctctcaaaggcgaagattgaaccggatgggagaaaaagaacactgttggatattgaaaatgccatacgcaatgg
tgccgacaataagaaaccaaaactcaagtgccaaaagaagggtacgatgactgaattggttgagatcactctttgcagtg
ataaaagcggagaccatttcatagattgcccccacccctttgaaccaatatcaccacattattgccccaccaacaatatc
aagtat
back to top
>EF494757.1-S-RNase.m1566
cggctgcctgcaactctaatcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaagagagcaaaaacactcgaaccccagttgga
aattatttggccgaacgtcctcgatcgaacaaatcatacaggattctggcgtagacagtggaaaaaacatggcacctgtg
ggtatcccacaatacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgagaaacaaaacgtctct
cgaatcctctcaaatgcaaagattgaaccagacgggcaaagcagaccgctggtggacattgaaaatgccatacgcaacgg
tacccacaataaaaaaccaaaattcaagtgccaaaagaataatggggtgactgaattggttgagatcactctttgcagcg
ataaaaacagagcacacttcattgattgccccaacccctttctacccggatcaccatatctgtgccccaacatcagtatc
cagtat
back to top
>EF494756.1-S-RNase.m1552
aatcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttcaaacagctcgggaaatga
cccaatatactgcaagaatacaaccctgaattctactaagatagcaaatctgacagcccagttggaaattatttggccca
acgtactggatcgaaccgatcatataaccttctggaataaacagtggaacaaacatggtagctgtgggcatcccgcaata
cagaacgacatgcattacttgcaaacagtaatcaacttgtacataacccagaaacaaaacgtctctgaaatcctctcaaa
ggcgaagattgaaccggtggggaaattcaggacacagaaggaaattgaaaaggccatacgcaaaggtaccaacaataagg
aaccaaaactcaagtgccaaaagaatactcagaggactgaattggttgaggtcactatttgtagcgatcgcaacttaaag
cagttcatanactgtccccgccctattttaaatggatcacgatactactgccccatcaataatattctgtat
back to top
>EF494755.1-S-RNase.m1550
taatccaactccttgtaaggatcctactgacaagttgtttactgttcacggtttgtggccttcaaactcgaatggaaatg
acccaaaatattgcaacgcacagcaatatcagacgatgaaaatactcgaaccccagttggtaattatttggccgaacgta
ctcaatcgaaacgatcatgaaggcttctggcgtaaacagtgggagaaacatggctcctgtgcgtcttccccaatacagaa
ccagaagcattactttgatacagtaatcaaaatgtacacaaccaagaaacaaaacatctctgaaatcctctcaaaggcga
atataaaaccgggtaggaaaaacaggacactggtggatattgaaaatgccatacgcaatgttatcaacaatatgacacca
caattcaagtgccaaaagaatactaggacatcattgactgaattggttgaggtcggtctttgcagcgataacaacttaac
gcagttcataaattgcccacgcccatttccacaaggatcacggtatttctgccccaccaatattcagtat
back to top
>EF494754.1-S-RNase.m1561
tgcagctctaatcctactccttgtaaggatcctcctgacaagttgtttacggttcatggtttgtggccttcaaatgttaa
tggaagtgaacccaagaaatgcaaaactacaatcttgaaccctcaaacgataacaaatcttacagcccagctggaaatta
tttggccaaacgtactcaatcgaagggctcatgtacgcttctggcgtaaacagtggcgtaaacatggcacatgtgcgtac
cccacaatagcggacgacatgcattactttagcacagtaatcgaaatgtacataaccaagaaacaaaacgtctctgaaat
cctctcaaaggcgaaaattaaaccggagaagaaattcaggacacgggacgacattgtaaatgccataagccaaagtatcg
actataagaaaccaaaactcaagtgcaagaacaataatcagataactgaattggttgaggtcggtctttgcagcgataac
aacttaacgcagttcatagattgcccccgcccatttccacaaggatcaccagatttctgccccaccaataatatccagta
t
back to top
>EF494753.1-S-RNase.m1569
cggccgtatgcaactctaatcctactccttgtaacgatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacaggaatggacctgacccagaaaaatgcaagactacagccctgaattctcagaagataggaaatatgacagcccaatt
ggaaattatttggccgaacgtactcaatcgatccgatcacgtaggcttctgggaaagagagtggatcaaacatggcacct
gcgggtatcccacaataaaagacgacatgcattacttaaaaacagtaatcagaatgtacataacccagaagcaaaacgtc
tctgcaatcctctcaaaggccacgattcaaccgaacgggacaaacaggccactggtggatattgaaaatgccttacgccg
tggtaccaacaatacgaaaccaaaattcaagtgccaaaagaattctaggacgacgactgaattggttgaggtcactcttt
gcagtgatagagacttaacgaagttcataaattgcccccccggacctctaaaaggatcacggtttttctgcccccccagt
gttcagtat
back to top
>EF494752.1-S-RNase.m1483
ttgaatggacctcacccagaaaattgcacgaatgcaaccgtgaatgctcacaggataaaaaatatccaagcccagttgaa
aattatttggccgaacgtactcgatcgaaccaatcatgtaggcttctggaataaacagtggataaagcatggcagctgtg
ggaatcccccaataatgaacgacacgcattactttcaaacagtaatcaacatgtacataacccagaaacaaaacgtctct
gaaatcctctcaagggcgaagattgaaccgttgggaatacaaaggccactggtgcatattgacaaggccatacggaatag
tatcaacaataagaaaccaaaattcaagtgcaaaaagaatgctggggtgactgaattggttgagatcagtctttgcagcg
atcgcagcttaacgcagttcagagattgcccccacccatttccaccaggatcaccatatctctgccccgccgatattcag
tat
back to top
>EF494751.1-S-RNase.m1466
cagctgtctgcaactctaaacctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacttgaatggacctcacccagaaaattgcactaatgcaacagtgaattctcacaggttaaaaaatatccaagcccagtt
gaaaattatttggccgaacgtactcgatcgaaccaatcatgtaggcttctggaataaacagtggataaaacatggcagct
gtgggtatcccgcaataatgaacgacacgcattactttcaaacagtaatcaacatgtacataacccagaaacaaaacgtc
tctgaaatcctctcaaaggcgaagattgaaccgttgggaatacaaaggccactggtgcatattgaaaatgccatacggaa
tagtatcaacaataagaaaccaaaattcaagtgccaaaagaattctggggtgactgaattggttga
back to top
>EF494750.1-S-RNase.m1566
cagctgtctgcnnctttaatcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacttgaatggacctcacccagaaaattgcacgaatgcaaccgtgaattctcagaggataacaaatatccaagcccagtt
gaaaattatttggccgaacgtactcgatcgaaccaatcatgtaggcttctggaataaacagtggataaaacatggcagct
gtgggaatcccccaataatgaacgacacgcattactttcaaacagtaatcaacatgtacataaccaagaaacaaaacgtc
tctggaatcctctcaaaggcgaagattgaaccggtgggggggaaaaggccactggtggatattgaaaatgccatacggaa
gagtatcaacaataagaaaccaaaattcaagtgccaaatgaagaataaggtgactaaattggttgagatcagtctttgca
gcgatggcagcttaactcagttcataaattgcccccgcccatttctagcaggatcaccatatctctgcccttccgatatt
gagtat
back to top
>EF464322.1-S-RNase.m1448
cggctgcctgcaactctaatcctactccttgtaaggatcctcctgacaagttgtttacggttcacggtttgtggccttca
aacaaaataggacgtgacccagaatattgcaagacaaggaatcgtcggaagagagcaaaaacactcgaaccccagttgga
aattatttggccgaacgtcctcgatcgaacaaatcatacaggattctggcgtagacagtggaaaaaacatggcacctgtg
ggtatcccacaatacagaacgagaatgattactttgaaacagtaatcaaaatgtacataaccgagaaacaaaacgtctct
cgaatcctctcaaatgcaaagattgaaccagacgggcaaagcagaccgctggtggacattgaaaatgccatacgcaacgg
tacccacaataaaaaaccaaaattcaagtgccaaaagaataatggggt
back to top
>EF464321.1-S-RNase.m1451
cagctgtctgcagatctaatcctactccttgtaaggatcctactgacaagttgtttacggttcacggtttgtggccttca
aacttgaatggacctcacccagaaaattgcacgaatgcaaccgtgaatgctcacaggataaaaaatatccaagcccagtt
gaaaattatttggccgaacgtactcgatcgaaccaatcatgtaggcttctggaataaacagtggataaagcatggcagct
gtgggaatcccccaataatgaacgacacgcattactttcaaacagtaatcaacatgtacataacccagaaacaaaacgtc
tctgaaatcctctcaagggcgaagattgaaccgttgggaatacaaaggccactggtgcatattgacaaggccatacggaa
tagtatcaacaataagaaaccaaaattcaagtgcaaaaagaatgctggggt
back to top