S-Rnase, S-Rnase (gene) Malus x domestica

Gene Overview
Name S-Rnase
Gene Symbol S-Rnase
Type gene
Organism Malus x domestica
Synonym S-RNase I
Description growth inhibitory activity of apple pollen
Comment self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S-RnaseAB017636.1-S-Rnase.m1Malus x domesticamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB017636.1-S-Rnase.m1 N/A AB017636.1

Sequence(s):
>AB017636.1-S-Rnase.m1603
tacgattattttcaatttacgcagcaatatcagccggccgtatgcaactctaatcctactccttgtaacgatcctcctga
aaaattgtttacggttcacggtttgtggccttcaaacaagaatggacctgacccagaaaaatgcaagaatatacaaatga
attctcagaagataggaaatatggcagcccagttggaaattatttggccgaacgtactcaatcgaactgatcatgtaggc
ttctgggaaagagagtggctcaaacatggcacctgcgggtatcccacaataagggacgacatgcattacttaaaaacagt
aatcaaaatgtacataacccagaaacaaaacgtctctgcaattctcgcaaaggcgatgattcaaccgaacgggcaaaaca
ggtcattggtggatattgaaaatgccatacgcagtggtaccaacaatatgaaaccaaaattcaagtgtcaaaagaatact
aggacaacgacggaattggttgaggtcactctttgccgtgatagagacttaacgaagttcataaattgcccccaaccacc
acaaggatcacgatatctctgccccgccgatgttcagtattaa
back to top