S1-RNase, S1-RNase (gene) Eriobotrya japonica

Gene Overview
Name S1-RNase
Gene Symbol S1-RNase
Type gene
Organism Eriobotrya japonica
Synonym self-incompatibility associated ribonuclease
Description NA
Comment S1-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseJQ247984.1-S1-RNaseEriobotrya japonicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseJQ247984.1-S1-RNase.m1Eriobotrya japonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseEriobotrya japonicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ247984.1-S1-RNase N/A JQ247984.1
mRNA parsed from NCBI nr database JQ247984.1-S1-RNase.m1 N/A JQ247984.1

Sequence(s):
>JQ247984.1-S1-RNase728
ccaaactgatttgatgactaagtatggcgatgaggtgaggatcctcctgacaagttgtttactgttcacggtttgtggcc
ttcagactcgaatggaaataacccaaaatattgcaaggcgccgccatatcagacggtaatattattagcataatcagatg
gtcaatattgtttatctcatttatgtacttgtgtgtgtatgtatatttttggataatgctagggccatcaaatgatgtgt
cacgataggatataagaaatttaatctttctatcattactctatattttttgacatatactcaacacaggttttctaaca
ggcgtgtacaaatattacaattaatttaaaatttaatcataaattatttctattatatattattatattgtcagatgaaa
atactcgaaccccagttggtaattatttggccgaacatactcaatcgaaacgatcatgaagtcttctggcgtaaacagtg
ggataaacatggctcctgtgcgtcttccccaatacagaaccagacgcattactttgatacagtaatcaaaatgtacacaa
cgcagaaacaaaacgtctctgaaatcctctcaaaggcgaatataaaacctggtaggaaaaacaggccactggtggatatt
gaaaatgccatacgcaatgttatcaacaatatgaccccaaaattcaagtgccaaaagaatactaagacatcattgactga
attggttg
back to top
>JQ247984.1-S1-RNase.m1435
gtgaggatcctcctgacaagttgtttactgttcacggtttgtggccttcagactcgaatggaaataacccaaaatattgc
aaggcgccgccatatcagacgatgaaaatactcgaaccccagttggtaattatttggccgaacatactcaatcgaaacga
tcatgaagtcttctggcgtaaacagtgggataaacatggctcctgtgcgtcttccccaatacagaaccagacgcattact
ttgatacagtaatcaaaatgtacacaacgcagaaacaaaacgtctctgaaatcctctcaaaggcgaatataaaacctggt
aggaaaaacaggccactggtggatattgaaaatgccatacgcaatgttatcaacaatatgaccccaaaattcaagtgcca
aaagaatactaagacatcattgactgaattggttg
back to top