S1-RNase, S1-RNase (gene) Malus x domestica

Gene Overview
Name S1-RNase
Gene Symbol S1-RNase
Type gene
Organism Malus x domestica
Synonym S1-ribonuclease
S1-RNase
Description NA
Comment self-incompatibility ribonuclease
self-incompatibility RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseHQ689389.1-S1-RNaseMalus x domesticagene
S1-RNaseHQ689388.1-S1-RNaseMalus x domesticagene
S1-RNaseHQ689387.1-S1-RNaseMalus x domesticagene
S1-RNaseHQ689386.1-S1-RNaseMalus x domesticagene
S1-RNaseEU427454.1-S1-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseHQ689389.1-S1-RNase.m1Malus x domesticamRNA
S1-RNaseHQ689388.1-S1-RNase.m1Malus x domesticamRNA
S1-RNaseHQ689387.1-S1-RNase.m1Malus x domesticamRNA
S1-RNaseHQ689386.1-S1-RNase.m1Malus x domesticamRNA
S1-RNaseEU427454.1-S1-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ689389.1-S1-RNase N/A HQ689389.1
gene parsed from NCBI nr database HQ689388.1-S1-RNase N/A HQ689388.1
gene parsed from NCBI nr database HQ689387.1-S1-RNase N/A HQ689387.1
gene parsed from NCBI nr database HQ689386.1-S1-RNase N/A HQ689386.1
gene parsed from NCBI nr database EU427454.1-S1-RNase N/A EU427454.1
mRNA parsed from NCBI nr database HQ689389.1-S1-RNase.m1 N/A HQ689389.1
mRNA parsed from NCBI nr database HQ689388.1-S1-RNase.m1 N/A HQ689388.1
mRNA parsed from NCBI nr database HQ689387.1-S1-RNase.m1 N/A HQ689387.1
mRNA parsed from NCBI nr database HQ689386.1-S1-RNase.m1 N/A HQ689386.1
mRNA parsed from NCBI nr database EU427454.1-S1-RNase.m1 N/A EU427454.1

Sequence(s):
>HQ689389.1-S1-RNase539
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccgt
tcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacggtaatattat
tagcataatcagatagtcaatattatttctctcatttatgtacttgtgtgtgtgtatatatatatttttggataatgcta
aagtcaccaagtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatcaacacttaaataataattcaat
catcaacatctacatcatttgattacaaaaaagtttgtcttcctagcattactctatattttttttatatatacatatac
tcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaaaatttaatcataaattatttctattatatat
tattatattgtcagataaaaatgctcgaaccccagttggtaatgatttggccgaacgta
back to top
>HQ689388.1-S1-RNase540
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccg
ttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacggtaatatta
ttagcataatcagatagtcaatattatttctctcatttatgtacttgtgtgtgtgtatatatatatttttggataatgct
aaagtcaccaagtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatcaacacttaaataataattcaa
tcatcaacatctacatcatttgattacaaaaaagtttgtcttcctagcattactctatattttttttatatatacatata
ctcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaaaatttaatcataaattatttctattatata
ttattatattgtcagataaaaatgctcgaaccccagttggtaatgatttggccgaacgta
back to top
>HQ689387.1-S1-RNase540
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccg
ttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgcaaggcaccgccatatcatacggtaatatta
ttagcataatcagatagtcaatattatttctctcatttatgtacttgtgtgtgtgtatatatatatttttggataatgct
aaagtcaccaagtttttaaaccaaattatgtgtcacagtagaaaataaacacgttaatcaacacttaaataataattcaa
tcatcaacatccacatcattttattacaaaaaagtttgtcttcctagcattactctatattttttttatatatacatata
ctcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaaaatttaatcataaattatttctattatata
ttattatattgtcagataaaaatgctcgaaccccagttggtaatgatttggccgaacgta
back to top
>HQ689386.1-S1-RNase540
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccg
ttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacggtaatatta
ttagcataatcagatagtcaatattatttctctcatttatgtacttgtgtgtgtgtatatatatatttttggataatgct
aaagtcaccaagtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatcaacacttaaataataattcaa
tcatcaacatctacatcatttgattacaaaaaagtttgtcttcctagcattactctatattttttttatatatacatata
ctcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttnaaatttaatcataaattatttctattatata
ttattatattgtcagatgaaaatactcgaaccccagttggtaatgatttggccgaacgta
back to top
>EU427454.1-S1-RNase538
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccgt
tcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacggtaatattat
tagcataatcagatagtcaatattatttctctcatttatgtacttgtgtgtgtgtatatatatatttttggataatgcta
aagtcaccaagtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatcaacacttaaataataattcaat
catcaacatctacatcatttgattacaaaaaagtttgtcttcctagcattactctatattttttttatatatacatatac
tcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaaaatttaatcataaattatttctattatatat
tattatattgtcagataaaaatgctcgaaccccagttggtaatgatttggccgaacgt
back to top
>HQ689389.1-S1-RNase.m1195
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccgt
tcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacgataaaaatgc
tcgaaccccagttggtaatgatttggccgaacgta
back to top
>HQ689388.1-S1-RNase.m1196
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccg
ttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacgataaaaatg
ctcgaaccccagttggtaatgatttggccgaacgta
back to top
>HQ689387.1-S1-RNase.m1196
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccg
ttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgcaaggcaccgccatatcatacgataaaaatg
ctcgaaccccagttggtaatgatttggccgaacgta
back to top
>HQ689386.1-S1-RNase.m1196
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccg
ttcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacgatgaaaata
ctcgaaccccagttggtaatgatttggccgaacgta
back to top
>EU427454.1-S1-RNase.m1194
tttacgcagcaatatcagccggctgtctgcaactctaatccaactccttgtaaggatcctcctgacaagttgtttaccgt
tcacggtttgtggccttcaaactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatacgataaaaatgc
tcgaaccccagttggtaatgatttggccgaacgt
back to top