S1-RNase, S1-RNase (gene) Prunus mira

Gene Overview
Name S1-RNase
Gene Symbol S1-RNase
Type gene
Organism Prunus mira
Synonym self-incompatibility associated ribonuclease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseAB597200.1-S1-RNasePrunus miragene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseAB597200.1-S1-RNase.m1Prunus miramRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus miragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB597200.1-S1-RNase N/A AB597200.1
mRNA parsed from NCBI nr database AB597200.1-S1-RNase.m1 N/A AB597200.1

Sequence(s):
>AB597200.1-S1-RNase872
ttgttgttggttttgctttcttcttgtgtttcgttatgagcaccggtgggttgcattacaatcttttgctctttatatcc
tatacgctaattagcatgcattgcattttcctacttatattttatgtttagagaaatattgtgtgtattggatgatacag
gtgacatgcgctgcattgaattagctttaatcttctcacaataattttggcaggatcttatgtctactttcaatttgtgc
aacaatggccaccggccacctgcatacgtagcaagaaaccttgctccaaacaccgggcatttcaaaatttcaccatccat
ggcctatggccaagcaattattcaaatccaacgaggcccagcaattgcgttgggtcgcattttaacgaaagtaaattggt
atgtattgtttcattattttttcaattactctagcattttgtaaataaaatgtatttacaaaatgataggtattttttca
attactttatccaaaattgaaaatctaaccatagcttgagtttttactttttctcaaaaaatgtatatattgcttggatg
tctcagtcccctcaattgatatcgaaattgaggatatcttggcctgacgtggaaagtggcaatgacacccaattttggga
aggcgaatggaacaaacatggtaaatgttcccaagagaaacttaaccaaatgcaatacttcgagcgatcccacgacatgt
ggatgtcttacaatatcacggatatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacctactccgac
atagtttcagccattaagcgtaaaactcaaagaacacccctcgttcgttgcaaacgtgatccagcaccgaat
back to top
>AB597200.1-S1-RNase.m1536
ttgttgttggttttgctttcttcttgtgtttcgttatgagcaccggatcttatgtctactttcaatttgtgcaacaatgg
ccaccggccacctgcatacgtagcaagaaaccttgctccaaacaccgggcatttcaaaatttcaccatccatggcctatg
gccaagcaattattcaaatccaacgaggcccagcaattgcgttgggtcgcattttaacgaaagtaaattgtcccctcaat
tgatatcgaaattgaggatatcttggcctgacgtggaaagtggcaatgacacccaattttgggaaggcgaatggaacaaa
catggtaaatgttcccaagagaaacttaaccaaatgcaatacttcgagcgatcccacgacatgtggatgtcttacaatat
cacggatatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacctactccgacatagtttcagccatta
agcgtaaaactcaaagaacacccctcgttcgttgcaaacgtgatccagcaccgaat
back to top