S1-RNase, S1-RNase (gene) Prunus persica

Gene Overview
Name S1-RNase
Gene Symbol S1-RNase
Type gene
Organism Prunus persica
Synonym S1-RNase protein
S1-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus persicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseDQ269994.1-S1-RNase.m1Prunus persicamRNA
S1-RNaseAB252415.1-S1-RNase.m1Prunus persicamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ269994.1-S1-RNase.m1 scaffold_6:26447285..26447808
DQ269994.1
mRNA parsed from NCBI nr database AB252415.1-S1-RNase.m1 N/A AB252415.1

Sequence(s):
>DQ269994.1-S1-RNase.m1191
ttcaccattcatggcctatggccaagcaattattcaaacccaaagatgcccagtaattgcacagggtcgcaatttaagaa
acagaatttgtacccttatatgcaatccaaactgaagatatcttggccggacgtggaaagtgggaatgatacaaaatttt
gggaaggcgaatggaacaaacacggcagata
back to top
>AB252415.1-S1-RNase.m1693
atggggatgctgaaatcgtcactcgctttccttgttcttgcttttgctttcttcatgtgtttcactacgagcgctggtga
tggatcttacgactattttcaatttgtgcaacaatggccacctaccaactgcagagttcgcatcaagcaaccttgctcca
atccccggccattacaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgc
aatgggtcgaaatttgaggcaaataaattgtcccctgaaatgcgaacaaaactgaagaaatcttggccggacgtggaaag
tggcaatgatacaaaattttgggcaggcgaatggaacaaacacggtaaatgttccgaacagacactaaaccaaatgcaat
acttcgagcgatccttcgcaatgtggaagtcatacaatattacagaaatccttaaaaacgcttcaatcgtaccaagtgcg
acacaaacatggaagtactcggatatagtatcaccaattaaagcagtaacaaaaacaacaccgctccttcgctgcaaata
tgatctatcacaccctaataagcctgagttgttacatgaagtggtactttgtttggattataatgcgctaatacagattg
actgtaatcgaacagcaggatgccgaaatcaacaagccatctggtttcaataa
back to top