S1-RNase, S1-RNase (gene) Prunus pseudocerasus

Gene Overview
Name S1-RNase
Gene Symbol S1-RNase
Type gene
Organism Prunus pseudocerasus
Synonym S1-RNase
S-RNase
Description NA
Comment self-(in)compatibility protein
S-locus S-RNase; involved in the reaction of self-(in)compatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus pseudocerasusgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseEU038302.1-S1-RNase.m1Prunus pseudocerasusmRNA
S1-RNaseEU073938.1-S1-RNase.m1Prunus pseudocerasusmRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU038302.1-S1-RNase.m1 N/A EU038302.1
mRNA parsed from NCBI nr database EU073938.1-S1-RNase.m1 N/A EU073938.1

Sequence(s):
>EU038302.1-S1-RNase.m1189
tcacaattcatggcctatggcctagtaattattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttgataca
aggaaagtgtcccctaaaatgcgaatcaagctgaagaaatcttggccagacgtggaaagtggcaatgatacaagattttg
gaaagacgaatggaacaaacacggcacat
back to top
>EU073938.1-S1-RNase.m1675
atggcgatgttggaaccgtcactcgctttccttgttcttgcttttgctttcttcttttgtttcgttatgagcactggttc
ttatgactattttcaatttgtgcaacagtggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaatcccc
ggccattacaatatttcaccatccatggcctatggcctagtaattattcaaacccaacgaagcccagtaattgcaatggg
tcgcaatttgatacaaggaaagtgtcccctaaaatgcgaatcaagctgaagaaatcgtggccagacgtggaaagtggcaa
tgatacaagattttggaaagacgaatggaacaaacatggtacatgttccgaagagagacttaaccaaatgcaatacttcg
agcgatcccacgatatgtggttgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggacatactcggacatagtatcacccattaaaacagcaactggaagaacacccacccttcgctgcaaacaggataa
gaagactcagttgttacatgaagtggtattttgttatgaatataatgcgttaaagcagattgactgtaatcgaacagcag
gatgccaaaatcaaccaaccatctcgtttcaataa
back to top