S1-RNase, S1-RNase (gene) Prunus simonii

Gene Overview
Name S1-RNase
Gene Symbol S1-RNase
Type gene
Organism Prunus simonii
Synonym S1-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseEU376959.1-S1-RNasePrunus simoniigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseEU918171.1-S1-RNase.m1Prunus simoniimRNA
S1-RNaseEU376959.1-S1-RNase.m1Prunus simoniimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus simoniigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU376959.1-S1-RNase N/A EU376959.1
mRNA parsed from NCBI nr database EU918171.1-S1-RNase.m1 N/A EU918171.1
mRNA parsed from NCBI nr database EU376959.1-S1-RNase.m1 N/A EU376959.1

Sequence(s):
>EU376959.1-S1-RNase873
tcttatgactattttcaatttgtgcaacaatggccaccgaccaactgcaaaattcgcaagaaatgctccaaaccccggcc
attacaaatgttcaccatccatggcctatggccaagtaatcattcaaacccaacgacgcccagtaattgcaatggggcgc
aatttgatgacaggaaagtggtatgtcattatttttttcacttactctttagcatttagttttttattttttgtatggag
atattagcatttagctcttagaaaaatgttgaatttttctgaaaagtactcggaagtgcttcttgaaaaaaacacaaatg
tgtttctccagaaagcgcttttaaaactcataaacacttttaaattgttttgtcaaatgtagacataagcacttttatta
gtcattttagaagcactcctaaacatacccttagtattgttgattgtatctttctcaaatcttatatccatttgagttta
tacttttttctcaaaatatatctatattgcttggatgtctcagtacccccgattgcgatccaaactgaagatatcttggc
cggacgtggaaaatggcaatgatacaaaattttgggaaggcgaatggaacaaacatggtagatgttccgaacagacactt
aaccaaatgcagtacttcgagcgatcctacgaaatatggaacttgttcaatattgccaatatccttaaaaatgcttcaat
cgtaccaagtgcgacacaaacatggacctactccgacatagtatcaaatattaaagcagtaactcaaagaacacccctcc
ttcgttgcagacgcaatccagcatataataagagcgggccgaactctcagttgttacatgaagtggtattttg
back to top
>EU918171.1-S1-RNase.m1575
gttgttggttttgctttcttcttttgttacgttttgagcagtggatcttatgactattttcaatttgtgcaacaatggcc
accgaccaactgcaaaattcgcaagaaatgctccaaaccccggccattacaaatgttcaccatccatggcctatggccaa
gtaatcattcaaacccaacgacgcccagtaattgcaatggggcgcaatttgatgacaggaaagtgtacccccgattgcga
tccaaactgaagatatcttggccggacgtggaaaatggcaatgatacaaaattttgggaaggcgaatggaacaaacacgg
cagatgttccgaacagacacttaaccaaatgcagtacttcgagcgatcctacgaaatatggaacttgttcaatattacca
atatccttaaaaatgcttcaatcgtaccaagtgcgacacaaacatggacctactccgacatagtatcaaatattaaagca
gtaactcaaagaacacccctccttcgttgcagacgcaatccagcatataataagagcgggccgaactctcagttgctaca
tgaagtggtattgtg
back to top
>EU376959.1-S1-RNase.m1530
tcttatgactattttcaatttgtgcaacaatggccaccgaccaactgcaaaattcgcaagaaatgctccaaaccccggcc
attacaaatgttcaccatccatggcctatggccaagtaatcattcaaacccaacgacgcccagtaattgcaatggggcgc
aatttgatgacaggaaagtgtacccccgattgcgatccaaactgaagatatcttggccggacgtggaaaatggcaatgat
acaaaattttgggaaggcgaatggaacaaacatggtagatgttccgaacagacacttaaccaaatgcagtacttcgagcg
atcctacgaaatatggaacttgttcaatattgccaatatccttaaaaatgcttcaatcgtaccaagtgcgacacaaacat
ggacctactccgacatagtatcaaatattaaagcagtaactcaaagaacacccctccttcgttgcagacgcaatccagca
tataataagagcgggccgaactctcagttgttacatgaagtggtattttg
back to top