S1-RNase, S1-RNase (gene) Prunus webbii

Gene Overview
Name S1-RNase
Gene Symbol S1-RNase
Type gene
Organism Prunus webbii
Synonym S-RNase
S1 S-RNase
Description NA
Comment ribonuclease; PwS1 S-RNase; self-incompatibility related
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S1-RNaseDQ993660.1-S1-RNase.m1Prunus webbiimRNA
S1-RNaseDQ118142.1-S1-RNase.m1Prunus webbiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus webbiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ993660.1-S1-RNase.m1 N/A DQ993660.1
mRNA parsed from NCBI nr database DQ118142.1-S1-RNase.m1 N/A DQ118142.1

Sequence(s):
>DQ993660.1-S1-RNase.m1720
atgttgaaattatcgtcactcgctttccttgttcttggttttgctttcttcttgtgtttcattatgagcactggtgatgg
atcttatgactattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcaataaaccttgctccaaacccc
ggccgttacaaattttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatggg
tcgcaatttgaggccaagaaagtgtaccctcgattgcaatccaaactgaagatatcttggcccgacgtggaaagtggcaa
tgatacaaacttctgggaacgtgagtggaacaaacatggtacatgttcctcacggatacttaatcaaatgcaatacttcg
agcgatcgtacgaaatgtggagatcctacaatattacaaatatccttaaaaacgcttcaatcgtaccaagtgcgacacaa
acatggacctactccgatatagtatcacccattaaagcagtaactcagagaacacccctcctccgttgcaaatcacatcc
aacaaagcctaagggtcaggcgaagtctcagcctacgagccaggccaactctcagtttttacatgaagtggttctttgtt
ttgattataatgcgctgatacttatcgactgtaatcgaacagcaggatgccgtaatcaggttgacatcttatttgcataa
back to top
>DQ118142.1-S1-RNase.m1594
atggggatgttgaaatcgtcactcgctttccttgttcttgctgttgctttattcttgtgtttcattatgagcactggatc
ttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcatacgtagcaagaaaccttgctccaaacaccggc
cactacaaattttcaccatccatggcctatggccaagcaattattcaaacccaaagaggcccagtaattgcgctgggtcg
cggtttaactttacgaaagtgtaccctcaattgcgaaacaaactgaagatatcttggcccgacgtggaaggtggcaatgt
tacaaaattctgggaaggtgaatggaacaaacatggcacatgttcggaggagagacttaaccaaatgcaatacttcgagc
gatcccacgacatgtggatgtcgtacaatattacaaagatccttaaaaacgcttcaatcgtaccgagtgcaacacaaaca
tggagctacgcggacatagtatcagccattaagacagcgactaaaagaacgcccctcctctgttgcaaacctgatccaca
gcctaataagcctcagttgttacatgaagtggta
back to top