S14A-RNase, S14A-RNase (gene) Prunus armeniaca

Gene Overview
Name S14A-RNase
Gene Symbol S14A-RNase
Type gene
Organism Prunus armeniaca
Synonym S14a-RNase
Description NA
Comment SI
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S14A-RNaseGU574199.1-S14A-RNasePrunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S14A-RNaseGU574199.1-S14A-RNase.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU574199.1-S14A-RNase N/A GU574199.1
mRNA parsed from NCBI nr database GU574199.1-S14A-RNase.m1 N/A GU574199.1

Sequence(s):
>GU574199.1-S14A-RNase486
gatttcaccatccatggcctatggccaagtaactattcaaacccaaggaagcccagtaattgcaatgggtcgcgatttaa
ctttaggaaagtggtatgtattgttttttttttttaacttactctttagcatttagttctaaaaaattagattgtcatct
gatgataatatactttcttggtagataaaattgtaatgttggttttctggttaggaacattattttgcatatgtacctaa
gtataaaattggaactaaattgaaaggataaaaataaaaattcaatttaatactcccattttatccgataatgaaaatct
gtccctaatgtatttcccttttttttttctttttttttctttctaaaaatatgttatatatggcttggatgtctcagtac
cctcaattgcgaaataaactgaagatatcttggcccgacgtggaaggtggcaacgatacaaaattttgggaaggtgaatg
gaacaa
back to top
>GU574199.1-S14A-RNase.m1182
gatttcaccatccatggcctatggccaagtaactattcaaacccaaggaagcccagtaattgcaatgggtcgcgatttaa
ctttaggaaagtgtaccctcaattgcgaaataaactgaagatatcttggcccgacgtggaaggtggcaacgatacaaaat
tttgggaaggtgaatggaacaa
back to top