S15-RNase, S15-RNase (gene) Prunus armeniaca

Gene Overview
Name S15-RNase
Gene Symbol S15-RNase
Type gene
Organism Prunus armeniaca
Synonym self-incompatibility S15-RNase
S15-RNase
S15-RNase protein
Description NA
Comment ribonuclease
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S15-RNaseDQ870631.1-S15-RNase.m1Prunus armeniacamRNA
S15-RNaseEF173400.1-S15-RNase.m1Prunus armeniacamRNA
S15-RNaseDQ269999.1-S15-RNase.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ870631.1-S15-RNase.m1 N/A DQ870631.1
mRNA parsed from NCBI nr database EF173400.1-S15-RNase.m1 N/A EF173400.1
mRNA parsed from NCBI nr database DQ269999.1-S15-RNase.m1 N/A DQ269999.1

Sequence(s):
>DQ870631.1-S15-RNase.m1189
tcacaattcatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaacgggtcgcaatatgacgac
aggaaagtgtaccctgatttgcgatccgatctgaaaagatcttggcccgacgtggaaagtggcaatgatacaaaattttg
ggaaggcgaatggaacaaacacggcagtt
back to top
>EF173400.1-S15-RNase.m1575
tctcgcttttccttgttcttgcttttgctttcttcttgtgtttcattatgagcactggatcttatgtctattttcaattt
gtgcaacagtggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaatccccggccattacaatatttcac
catccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttgatgcaagga
aagtgtcccctaaaatgcgaatcaagctgaagaaatcttggccagacgtggaaagtggcaatgatacaagattttggaaa
gacgaatggaacaaacatggtacatgttccgaagagagacttaaccaaatgcaatacttcgagcgatcccacgatatgtg
gttgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccacatccgacacaaacatggacatactcggaca
tagtatcaccccttaaaacagcaactggaagaacacccacccttcgctgcaaacaggataagaagactcagctgttacat
gaagtggtattttga
back to top
>DQ269999.1-S15-RNase.m1191
ttcaccattcatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcgcaatttgatgc
aaggaaagtgtcccctaaaatgcgaatcaagctgaagaaatcttggccagacgtggaaagtggcaatgatacaagatttt
ggaaagacgaatggaacaaacacggcacata
back to top