S15-RNase, S15-RNase (gene) Prunus mume

Gene Overview
Name S15-RNase
Gene Symbol S15-RNase
Type gene
Organism Prunus mume
Synonym S15-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus mumegene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S15-RNaseEU020122.1-S15-RNase.m1Prunus mumemRNA
S15-RNaseDQ903312.1-S15-RNase.m1Prunus mumemRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU020122.1-S15-RNase.m1 N/A EU020122.1
mRNA parsed from NCBI nr database DQ903312.1-S15-RNase.m1 N/A DQ903312.1

Sequence(s):
>EU020122.1-S15-RNase.m1669
atggggaagttgaaatcgtcgctcgctttccttgttcttgcttttgctttcttcttgtgtttcattatgagcactggatc
ttatgactattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgaaccaaatgctccaacccccggccat
tacaatatttcaccatccatggcctatggccaagtaattattcaaacccgaagatgcccagtaattgcattgggtcgcaa
tttaacgaaagtagagtgtacccttatttgcgccccaaactgaagatatcttggccagacgtggaaagtggcaatgatac
aaaattttgggaaggcgaatggaacaaacatggtacatgttccgaacggatacttaaccaaatgcaatacttccagcgat
cccaagcaatgtggaaatcacacaatatttctgaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgg
acctactccgacatagtatcacccattaaaacagcaactaaaaaaacacccctccttcgttgcaaatatgataagaagac
tcagttgttatatgaagtggtattttgttatggatataatgcgttaaagcacattgactgtaatcgaaccgcaggatgcc
gaaatcaacaagccatctcgtttcaataa
back to top
>DQ903312.1-S15-RNase.m1167
ctatggccaagtaattattcaaacccgaagatgcccagtaattgcattgggtcgcaatttaacgaaagtagagtgtaccc
ttatttgcgccccaaactgaagatatcttggccagacgtggaaagtggcaatgatacaaaattttgggaaggcgaatgga
acaaaca
back to top