S16-RNase, S16-RNase (gene) Pyrus x bretschneideri

Gene Overview
Name S16-RNase
Gene Symbol S16-RNase
Type gene
Organism Pyrus x bretschneideri
Synonym S16-RNase
Description NA
Comment associated with self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus x bretschneiderigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S16-RNaseEF643635.1-S16-RNase.m1Pyrus x bretschneiderimRNA
S16-RNaseDQ991388.1-S16-RNase.m1Pyrus x bretschneiderimRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF643635.1-S16-RNase.m1 N/A EF643635.1
mRNA parsed from NCBI nr database DQ991388.1-S16-RNase.m1 N/A DQ991388.1

Sequence(s):
>EF643635.1-S16-RNase.m1687
atggggattacgaggatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcccctacggtagg
atacgattattttcaatttacgcagcaatatcagccggctgtctgccactttaatcctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagcacaggaaatgaccccatatactgcaagaatacaaccatg
aattctactaagatagcaaatctgacagcccggttggaaattatttggccgaacgtgctcgatcgagccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcatcccgcaatacagaacgacatgcattacttgcaaacag
taatcaaaatgtacataacccagagacaaaacgtctctgaaatcctctcaagggcgaagattgaaccggtggggaaattc
aggacacagaaggaaattgaaatggcaatacgcaaaggtaccaacaataaggaaccaaaactcaagtgccaaaacaatac
taagaggactgaattggttgaggtcactatttgcagcgatcgcaacttaaagcacttcatagattgtccccgccctattt
taaatggatcacgatactactgccccaccaataatattctgtattaa
back to top
>DQ991388.1-S16-RNase.m1687
atggggattacgaggatgatatatatggttacgatggtattttcattaattgtattaatattgtcttcccctacggtagg
atacgattattttcaatttacgcagcaatatcagccggctgtctgccactttaatcctactccttgtaaggatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagcacaggaaatgaccccatatactgcaagaatacaaccatg
aattctactaagatagcaaatctgacagcccggttggaaattatttggcccaacgtgctcgatcgagccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcatcccgcaatacagaacgacatgcattacttgcaaacag
taatcaaaatgtacataacccagagacaaaacgtctctgaaatcctctcaagggcgaagattgaaccggtggggaaattc
aggacacagaaggaaattgaaatggcaatacgcaaaggtaccaacaataaggaaccaaaactcaagtgccaaaacaatac
taagaggactgaattggttgaggtcactatttgcagcgatcgcaacttaaagcacttcatagattgtccccgccctattt
taaatggatcacgatactactgccccaccaataatattctgtattaa
back to top