S17-RNase, S17-RNase (gene) Prunus armeniaca

Gene Overview
Name S17-RNase
Gene Symbol S17-RNase
Type gene
Organism Prunus armeniaca
Synonym self-incompatibility S17-RNase
S-RNase
S17-RNase protein
Description NA
Comment ribonuclease
pistil self-incompatibility protein
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S17-RNaseEU516388.1-S17-RNasePrunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S17-RNaseDQ870633.1-S17-RNase.m1Prunus armeniacamRNA
S17-RNaseEU516388.1-S17-RNase.m1Prunus armeniacamRNA
S17-RNaseDQ270001.1-S17-RNase.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU516388.1-S17-RNase N/A EU516388.1
mRNA parsed from NCBI nr database DQ870633.1-S17-RNase.m1 N/A DQ870633.1
mRNA parsed from NCBI nr database EU516388.1-S17-RNase.m1 N/A EU516388.1
mRNA parsed from NCBI nr database DQ270001.1-S17-RNase.m1 N/A DQ270001.1

Sequence(s):
>EU516388.1-S17-RNase1102
tcattatgagcactggtgatggtgggttgcagtacaatcttttgctctttatatcctatatgcataaatcagcattgcat
ttttctacttgtactttttgttcagagaaactatttcaactttattcacatatttttcatcctttattctaacgcacaac
tttctttggatgagtaatttggggattgtttttctgcatgtgctctttttctattttcatactcttttgtttattctgat
aattgttacaacgtctattcatcacaataattttggcaggatcttatgactattttcaatttgtgcaacaatggccaccg
accaactgcagagttcgaaccaaatgctccaacccccggccattacaatatttcaccatccatggcctatggccaagtaa
ttattcaaacccgaagatgcccagtaattgcattgggtctcaatttaacgaaagtagagtggtatgtatttttcattatt
cttttcacatgtatagttcttagaaaattagactgacatttgaaaatagaataaaccacaattgatgttggtctctgcta
ggcacgtatatatatataataatgaatctgatcatcaaaatgcaatgttgatcctttcattaaatcttgaatgtaactat
cccttacgtttttactgttgtctctcaaaatatattgcttggatgtctcagtacccttatttgcgccccaaactgaagat
atcttggccagacgtggaaagtggcaatgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttccgaac
ggatacttaaccaaatgcaatacttccagcgatcccaagcaatgtggaaatcacacaatatttctgaaatccttaaaaac
gcttcaatcgtaccacatccgacacaaacatggacctactccgacatagtatcacccattaaaacagcaactaaaagaac
acccctccttcgttgcaaatatgataagaagactcagttgttacatgaagtggtattttgttatggatataatgcgttaa
agcacattgactgtaatcgaaccgcaggatgccgaaatcaacaagccatctcgtttcaataa
back to top
>DQ870633.1-S17-RNase.m1189
tcaccattcatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgtaatgggtcgcaatttgaggac
aggaaagtttaccctcaacttcggaccaaactgaagaaatcttggcccgacgtggaagatgggaatgatacaaaattttg
ggaaggtgaatggaacaaacacggcagat
back to top
>EU516388.1-S17-RNase.m1614
tcattatgagcactggtgatggatcttatgactattttcaatttgtgcaacaatggccaccgaccaactgcagagttcga
accaaatgctccaacccccggccattacaatatttcaccatccatggcctatggccaagtaattattcaaacccgaagat
gcccagtaattgcattgggtctcaatttaacgaaagtagagtgtacccttatttgcgccccaaactgaagatatcttggc
cagacgtggaaagtggcaatgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttccgaacggatactt
aaccaaatgcaatacttccagcgatcccaagcaatgtggaaatcacacaatatttctgaaatccttaaaaacgcttcaat
cgtaccacatccgacacaaacatggacctactccgacatagtatcacccattaaaacagcaactaaaagaacacccctcc
ttcgttgcaaatatgataagaagactcagttgttacatgaagtggtattttgttatggatataatgcgttaaagcacatt
gactgtaatcgaaccgcaggatgccgaaatcaacaagccatctcgtttcaataa
back to top
>DQ270001.1-S17-RNase.m1188
ttcaccattcatggcctatggccaagtaattattcaaacccaaggttgcccagtaattgcattgggtcgcaatttaaggg
aatattgtcccctcaattgcggtccaaactgaagacatcatggccggacgtggaaggtggcaatgatacaaagttttggg
aaggcgaatggaacaaacacggcacata
back to top