S19-RNase, S19-RNase (gene) Malus x domestica

Gene Overview
Name S19-RNase
Gene Symbol S19-RNase
Type gene
Organism Malus x domestica
Synonym S19-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S19-RNaseAB094493.1-S19-RNaseMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S19-RNaseAB094493.1-S19-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB094493.1-S19-RNase N/A AB094493.1
mRNA parsed from NCBI nr database AB094493.1-S19-RNase.m1 N/A AB094493.1

Sequence(s):
>AB094493.1-S19-RNase164
ccggccgtatgcaactctaatcctactccttgtaacgatcctcctgacaagttgtttacggttcacggtttgtggccttc
aaacaagaatggacctgacccagaaaaatgcaagactacagccctgaattctcagaagataggaaatatgacagcccaat
tgga
back to top
>AB094493.1-S19-RNase.m1164
ccggccgtatgcaactctaatcctactccttgtaacgatcctcctgacaagttgtttacggttcacggtttgtggccttc
aaacaagaatggacctgacccagaaaaatgcaagactacagccctgaattctcagaagataggaaatatgacagcccaat
tgga
back to top