S2-RNase, S2-RNase (gene) Malus x domestica

Gene Overview
Name S2-RNase
Gene Symbol S2-RNase
Type gene
Organism Malus x domestica
Synonym S2-RNase precursor
Description pistil rejection of S2-pollen
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseU12199.1-S2-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database U12199.1-S2-RNase.m1 chr17:21481498..21482332
chr17:23476769..23477603
U12199.1

Sequence(s):
>U12199.1-S2-RNase.m1687
atggggactacgcggatggtatatatagttacgatgttattttcattaattgtattaatattgtcttcgtctacggtggg
atacgattattttcaatttacgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaaagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacatgaatcgaagtgaattatttaattgcagtagttcaaacgtg
acttatgcgaagatacaaaatatccgaacccagttggaaatgatttggccaaacgtattcaatcgaaaaaatcatttagg
cttctggaatagagagtggaacaaacacggcgcctgtgggtatcccacaatacggaacgacttgcattactttcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgatatcctctcaaaggccaagattgaaccggatggaaatatc
aggacacagaaggaaattgtagatgccataagaaaaggtatccatggtaaggaaccaaacctcaagtgccaaaagaatac
tcagatgactgaattggttgaggtcactctttgcagcgatggcaacttaaagcagttcatagattgcccccaccattttc
caaatggatcacgacataactgccccaccaatcatattctgtattaa
back to top