S2-RNase, S2-RNase (gene) Prunus armeniaca

Gene Overview
Name S2-RNase
Gene Symbol S2-RNase
Type gene
Organism Prunus armeniaca
Synonym self-incompatibility RNase S2
S2-RNase protein
Description NA
Comment S2-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseAY587562.1-S2-RNasePrunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseEF101907.1-S2-RNase.m1Prunus armeniacamRNA
S2-RNaseEF101906.1-S2-RNase.m1Prunus armeniacamRNA
S2-RNaseEF101905.1-S2-RNase.m1Prunus armeniacamRNA
S2-RNaseAY587562.1-S2-RNase.m2Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY587562.1-S2-RNase N/A AY587562.1
mRNA parsed from NCBI nr database EF101907.1-S2-RNase.m1 N/A EF101907.1
mRNA parsed from NCBI nr database EF101906.1-S2-RNase.m1 N/A EF101906.1
mRNA parsed from NCBI nr database EF101905.1-S2-RNase.m1 N/A EF101905.1
mRNA parsed from NCBI nr database AY587562.1-S2-RNase.m2 N/A AY587562.1

Sequence(s):
>AY587562.1-S2-RNase1622
atggcgatgttgaaatcgccactcgctttccttgttcttgctttcttcttgtgtttcataatgagcactggtgatggtgg
gttgcattacaatcttttgctctttatatgccatgtatgtgcatataatttgcattgaatttttctacttctattttatg
tgtggataactattgtatgttttcgatgatagggaggacttatatagcgcacaactttctttactctgatagtgttgcaa
taagtacagtattcatcattggaaaccttattgaagataccattaaccttttatcacaataattttggcaggaacttatg
actatttccaatttgtgcaacaatggccaccgaccacttgcggagttcgcgggaaaccttgctccaaaccccggctatta
caaaatttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcctagtaattgcaatgggtcgaaatt
tgaggcaaggaaagtggtatgtattgtttttatttatttatttattaataaatgtatatataggtatacctatgtataga
tccctttataataatgtatgtatcatctaattaaaggcatataaattttcctgcaacggaatgcttggttagctctttat
ataattatccccttccaataagatggtgccatcaccatttcatacaaatttttctacttaaaaacctcctagttgttgga
tatgggtttacaaatggcaccatcttattggaaaggggatgattatgtggagagctgacctggcattcccgtgcccatga
aagtttctatcactttagaggagagaaagtaggtatggcaatggaacatcacttagggtgtgttccggttagagatatac
ccgaacaccatgctcgaaaattttccgcaaactcatccgtccttatattcgacttctagtttttataacccattagatcg
aagccctgcaactcgtggagaaatttgtcatccctaggaaaaagggataacctatcattttgtacttacgtagacattca
gtatttaaaatatactatttatgaaaggatcaaaatcaaaagtcaatttaatactcaggttcaatgggaaaaagagatcc
aagaatgaaagtctaatcattcctttagctttactcttttttatttaggaatttctgaataaatattgcttgtatgactc
agtaccctcaattgcgatccgatctgaagatatcttggccggacgtggaaagtggcaatgacacaaaattttgggaaggc
gaatggaacaaacatggaacatgttccgaacagatacttaaccaaatgcaatacttcgagcgatcccacgcaatgtggac
ctcgtacaatattacgaaaatccttaaaaatgcttcaatcgtaccaagtgcgaaacaaaaatggaagtactcggacatac
tatcacccattaaaacagcaactggaagaacgcccctccttcgttgcagaactgatcctgcactccgtaatgttcagttt
ttacatgaggtggtgttttgttatggatataatgcgttaaagcagattgactgtaatcgaacagcaggatgcaaaaatca
agttgacatcgtgtttaaataa
back to top
>EF101907.1-S2-RNase.m1191
ttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcctagtaattgcaatgggtcgaaatttgaggc
aaggaaagtgtaccctcaattgcgatccgatctgaagatatcttggccggacgtggaaagtggcaatgacacaaaatttt
gggaaggcgaatggaacaaacacggcacata
back to top
>EF101906.1-S2-RNase.m1191
ttcaccattcatggcctatggccaagtaattattcaaacccaacgatgcctagtaattgcaatgggtcgaaatttgaggc
aaggaaagtgtaccctcaattgcgatccgatctgaagatatcttggccggacgtggaaagtggcaatgacacaaaatttt
gggaaggcgaatggaacaaacacggcactta
back to top
>EF101905.1-S2-RNase.m1191
ttcaccattcatggcctatggccaagtagttattcaaacccaacgatgcctagtaattgcaatgggtcgaaatttgaggc
aaggaaagtgtaccctcaattgcgatccgatctgaagatatcttggccggacgtggaaagtggcaatgacacaaaatttt
gggaaggcgaatggaacaaacacggcacata
back to top
>AY587562.1-S2-RNase.m2681
atggcgatgttgaaatcgccactcgctttccttgttcttgctttcttcttgtgtttcataatgagcactggtgatggaac
ttatgactatttccaatttgtgcaacaatggccaccgaccacttgcggagttcgcgggaaaccttgctccaaaccccggc
tattacaaaatttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcctagtaattgcaatgggtcg
aaatttgaggcaaggaaagtgtaccctcaattgcgatccgatctgaagatatcttggccggacgtggaaagtggcaatga
cacaaaattttgggaaggcgaatggaacaaacatggaacatgttccgaacagatacttaaccaaatgcaatacttcgagc
gatcccacgcaatgtggacctcgtacaatattacgaaaatccttaaaaatgcttcaatcgtaccaagtgcgaaacaaaaa
tggaagtactcggacatactatcacccattaaaacagcaactggaagaacgcccctccttcgttgcagaactgatcctgc
actccgtaatgttcagtttttacatgaggtggtgttttgttatggatataatgcgttaaagcagattgactgtaatcgaa
cagcaggatgcaaaaatcaagttgacatcgtgtttaaataa
back to top