S2-RNase, S2-RNase (gene) Prunus cerasifera

Gene Overview
Name S2-RNase
Gene Symbol S2-RNase
Type gene
Organism Prunus cerasifera
Synonym S2-RNase
Description NA
Comment self-incompatibility RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseEF641276.1-S2-RNasePrunus cerasiferagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S2-RNaseEF641276.1-S2-RNase.m1Prunus cerasiferamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus cerasiferagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EF641276.1-S2-RNase N/A EF641276.1
mRNA parsed from NCBI nr database EF641276.1-S2-RNase.m1 N/A EF641276.1

Sequence(s):
>EF641276.1-S2-RNase787
ctatggccaagtaattattcaaacccaacaatgcccagtaattgcaatgggtcggaatttaagagaatattggtatgtat
tgtttctttttcttttattttttcacttactctttagcatctagtttaaataaaaaaaactagattgtcatctgaaaaaa
aaataaaaaattacttctttcagtagttagacacattgttattattatctttgttcagaaaaagaaaaaaaacagttagt
tgataaagtatcaaaagatgtacaacagacagccataatagtcaattcccaactttacacacattattatgaatatatac
aaattgtaagtacatctacgttacgttcatgtgtatattaatgtttctatgcatgcatttataatatatctaatcatcca
attttaaaacctatcattatgtatttttgtatatatttaaaatattgtacataataaaagataccaaaatcaaaattcaa
tttgatggtcaggttaaacgaagaaaacaatcttatccaagaatcagaatcgttttcactttttctcaaactatgtatat
attgcttggatgtctcagtcccctgaattgcgatccgatctgaagagatcttggccggacgtggaaagtggcgatgacat
aaaattttgggagggcgaatggaacaagcatggtaaatgttccgaacagacacttaaccaaatgcaatacttccagcgat
cccacgaaatgtggtacgcgttcaatattacagagatccttaaaaacgcttcaatcgtaccacatcc
back to top
>EF641276.1-S2-RNase.m1281
ctatggccaagtaattattcaaacccaacaatgcccagtaattgcaatgggtcggaatttaagagaatattgtcccctga
attgcgatccgatctgaagagatcttggccggacgtggaaagtggcgatgacataaaattttgggagggcgaatggaaca
agcatggtaaatgttccgaacagacacttaaccaaatgcaatacttccagcgatcccacgaaatgtggtacgcgttcaat
attacagagatccttaaaaacgcttcaatcgtaccacatcc
back to top